Incidental Mutation 'PIT4480001:Cobl'
ID554873
Institutional Source Beutler Lab
Gene Symbol Cobl
Ensembl Gene ENSMUSG00000020173
Gene Namecordon-bleu WH2 repeat
SynonymsC530045F18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location12236608-12464960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12253592 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1037 (S1037P)
Ref Sequence ENSEMBL: ENSMUSP00000045693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]
PDB Structure
Actin complex with Gelsolin Segment 1 fused to Cobl segment [X-RAY DIFFRACTION]
Crystal Structure of an Actin Dimer in Complex with the Actin Nucleator Cordon-Bleu [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000046755
AA Change: S1037P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: S1037P

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 144 235 2.2e-46 PFAM
low complexity region 328 333 N/A INTRINSIC
low complexity region 360 376 N/A INTRINSIC
low complexity region 408 433 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
coiled coil region 564 589 N/A INTRINSIC
WH2 1185 1205 1.32e0 SMART
WH2 1225 1245 6.36e-3 SMART
low complexity region 1276 1296 N/A INTRINSIC
WH2 1313 1333 3.91e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109650
AA Change: S955P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: S955P

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.6e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
coiled coil region 482 507 N/A INTRINSIC
WH2 1103 1123 1.32e0 SMART
WH2 1143 1163 6.36e-3 SMART
low complexity region 1194 1214 N/A INTRINSIC
WH2 1231 1251 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109651
AA Change: S1012P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: S1012P

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.2e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 383 408 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
coiled coil region 539 564 N/A INTRINSIC
WH2 1160 1180 1.32e0 SMART
WH2 1200 1220 6.36e-3 SMART
low complexity region 1251 1271 N/A INTRINSIC
WH2 1288 1308 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172919
SMART Domains Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.6e-41 PFAM
low complexity region 328 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172956
SMART Domains Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.4e-41 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174874
AA Change: S1030P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: S1030P

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Pfam:Cobl 175 253 1.2e-40 PFAM
low complexity region 321 326 N/A INTRINSIC
low complexity region 353 369 N/A INTRINSIC
low complexity region 401 426 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
low complexity region 519 534 N/A INTRINSIC
coiled coil region 557 582 N/A INTRINSIC
WH2 1178 1198 1.32e0 SMART
WH2 1218 1238 6.36e-3 SMART
low complexity region 1269 1289 N/A INTRINSIC
WH2 1306 1326 3.91e-3 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Cobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cobl APN 11 12375813 missense possibly damaging 0.89
IGL00698:Cobl APN 11 12253722 missense probably benign 0.41
IGL00772:Cobl APN 11 12266985 missense probably benign 0.02
IGL00922:Cobl APN 11 12254866 missense probably damaging 1.00
IGL00985:Cobl APN 11 12254843 missense probably damaging 1.00
IGL01641:Cobl APN 11 12309641 nonsense probably null
IGL01722:Cobl APN 11 12253987 missense probably benign 0.00
IGL01734:Cobl APN 11 12254980 splice site probably benign
IGL01924:Cobl APN 11 12254596 missense probably benign 0.30
IGL02105:Cobl APN 11 12249651 missense probably damaging 1.00
IGL02326:Cobl APN 11 12386712 missense possibly damaging 0.69
IGL02342:Cobl APN 11 12253672 missense possibly damaging 0.64
IGL02426:Cobl APN 11 12254351 nonsense probably null
IGL02754:Cobl APN 11 12254371 missense probably damaging 1.00
IGL02754:Cobl APN 11 12254370 missense probably damaging 1.00
IGL02811:Cobl APN 11 12253285 missense possibly damaging 0.56
IGL02859:Cobl APN 11 12369602 missense probably damaging 1.00
IGL02999:Cobl APN 11 12343869 missense possibly damaging 0.71
IGL03030:Cobl APN 11 12254241 missense possibly damaging 0.80
IGL03191:Cobl APN 11 12253364 missense probably benign 0.00
PIT4418001:Cobl UTSW 11 12256240 missense possibly damaging 0.79
PIT4495001:Cobl UTSW 11 12254596 missense probably benign 0.00
R0031:Cobl UTSW 11 12254945 missense probably benign 0.36
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0322:Cobl UTSW 11 12267072 missense probably damaging 1.00
R0597:Cobl UTSW 11 12254699 missense probably benign 0.24
R0733:Cobl UTSW 11 12365167 missense probably benign 0.31
R0734:Cobl UTSW 11 12375971 missense probably damaging 1.00
R0784:Cobl UTSW 11 12266843 splice site probably benign
R0884:Cobl UTSW 11 12375908 missense possibly damaging 0.89
R1065:Cobl UTSW 11 12254327 missense possibly damaging 0.67
R1331:Cobl UTSW 11 12375853 missense probably damaging 0.96
R1892:Cobl UTSW 11 12253258 missense probably damaging 0.99
R2847:Cobl UTSW 11 12378342 missense probably damaging 1.00
R2848:Cobl UTSW 11 12378342 missense probably damaging 1.00
R3407:Cobl UTSW 11 12375830 missense probably damaging 1.00
R4627:Cobl UTSW 11 12251093 missense probably damaging 1.00
R4662:Cobl UTSW 11 12253672 missense probably benign 0.08
R4677:Cobl UTSW 11 12386665 missense possibly damaging 0.93
R4844:Cobl UTSW 11 12254740 missense probably benign 0.10
R4942:Cobl UTSW 11 12254185 missense probably damaging 0.99
R5158:Cobl UTSW 11 12256198 missense possibly damaging 0.84
R5195:Cobl UTSW 11 12253565 missense probably benign 0.02
R5255:Cobl UTSW 11 12375825 missense probably damaging 1.00
R5588:Cobl UTSW 11 12343886 nonsense probably null
R5637:Cobl UTSW 11 12296531 intron probably benign
R5643:Cobl UTSW 11 12306948 splice site probably benign
R5749:Cobl UTSW 11 12266965 missense possibly damaging 0.86
R5953:Cobl UTSW 11 12256220 missense probably benign 0.00
R6000:Cobl UTSW 11 12369684 missense probably benign 0.08
R6373:Cobl UTSW 11 12253118 missense probably damaging 1.00
R7034:Cobl UTSW 11 12254177 missense probably damaging 1.00
R7071:Cobl UTSW 11 12254795 missense probably benign 0.00
R7077:Cobl UTSW 11 12253441 missense probably benign 0.04
R7078:Cobl UTSW 11 12378271 missense probably damaging 1.00
R7099:Cobl UTSW 11 12296540 missense
R7153:Cobl UTSW 11 12254128 missense probably damaging 1.00
R7448:Cobl UTSW 11 12256225 missense possibly damaging 0.46
R7519:Cobl UTSW 11 12253124 missense probably damaging 1.00
R7767:Cobl UTSW 11 12412117 start gained probably benign
R7772:Cobl UTSW 11 12254488 missense probably benign 0.29
R7841:Cobl UTSW 11 12253324 missense probably damaging 1.00
R7845:Cobl UTSW 11 12365139 missense probably benign 0.35
R7924:Cobl UTSW 11 12253324 missense probably damaging 1.00
R7928:Cobl UTSW 11 12365139 missense probably benign 0.35
R8026:Cobl UTSW 11 12253459 missense probably benign 0.01
R8118:Cobl UTSW 11 12254834 missense probably benign 0.03
R8192:Cobl UTSW 11 12249745 missense probably benign 0.07
R8320:Cobl UTSW 11 12267001 missense probably damaging 1.00
Z1176:Cobl UTSW 11 12253433 missense probably benign 0.02
Z1176:Cobl UTSW 11 12369645 missense probably damaging 1.00
Z1176:Cobl UTSW 11 12375827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGCCTGCGAGAAGTTAG -3'
(R):5'- CATGCTGATGTGGTGAGACC -3'

Sequencing Primer
(F):5'- CGAGAAGTTAGATGTTGAATTTGCC -3'
(R):5'- AGCAAAGCTGGCTAGATCTC -3'
Posted On2019-06-07