Incidental Mutation 'PIT4480001:Baiap2'
Institutional Source Beutler Lab
Gene Symbol Baiap2
Ensembl Gene ENSMUSG00000025372
Gene Namebrain-specific angiogenesis inhibitor 1-associated protein 2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #PIT4480001 (G1)
Quality Score93.0077
Status Not validated
Chromosomal Location119942763-120006782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119997087 bp
Amino Acid Change Threonine to Alanine at position 356 (T356A)
Ref Sequence ENSEMBL: ENSMUSP00000026436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026436] [ENSMUST00000075180] [ENSMUST00000103021] [ENSMUST00000106231] [ENSMUST00000106233]
Predicted Effect probably benign
Transcript: ENSMUST00000026436
AA Change: T356A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026436
Gene: ENSMUSG00000025372
AA Change: T356A

Pfam:IMD 17 237 6e-101 PFAM
PDB:4JS0|B 261 292 2e-13 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075180
AA Change: T356A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074674
Gene: ENSMUSG00000025372
AA Change: T356A

Pfam:IMD 17 237 3e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103021
AA Change: T316A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099310
Gene: ENSMUSG00000025372
AA Change: T316A

Pfam:IMD 17 237 2.5e-98 PFAM
PDB:4JS0|B 261 292 2e-12 PDB
SH3 338 397 9.77e-11 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 470 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106231
AA Change: T356A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101838
Gene: ENSMUSG00000025372
AA Change: T356A

Pfam:IMD 17 237 6.4e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106233
AA Change: T356A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101840
Gene: ENSMUSG00000025372
AA Change: T356A

Pfam:IMD 17 237 1.6e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been identified as a brain-specific angiogenesis inhibitor (BAI1)-binding protein. This adaptor protein links membrane bound G-proteins to cytoplasmic effector proteins. This protein functions as an insulin receptor tyrosine kinase substrate and suggests a role for insulin in the central nervous system. It also associates with a downstream effector of Rho small G proteins, which is associated with the formation of stress fibers and cytokinesis. This protein is involved in lamellipodia and filopodia formation in motile cells and may affect neuronal growth-cone guidance. This protein has also been identified as interacting with the dentatorubral-pallidoluysian atrophy gene, which is associated with an autosomal dominant neurodegenerative disease. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice show enhanced NMDA receptor-mediated synaptic transmission, enhanced long-term potentiation, and impaired learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Baiap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Baiap2 APN 11 119982010 missense probably benign
IGL00574:Baiap2 APN 11 120006408 missense probably damaging 0.99
IGL00960:Baiap2 APN 11 119999292 missense possibly damaging 0.78
R0637:Baiap2 UTSW 11 120000579 missense probably benign 0.00
R1682:Baiap2 UTSW 11 119997540 missense probably damaging 0.98
R2138:Baiap2 UTSW 11 119957102 missense possibly damaging 0.78
R2513:Baiap2 UTSW 11 119999226 missense probably benign 0.00
R4924:Baiap2 UTSW 11 119997024 missense probably damaging 1.00
R5389:Baiap2 UTSW 11 119996670 missense probably damaging 1.00
R5576:Baiap2 UTSW 11 119996911 missense probably benign 0.05
R6235:Baiap2 UTSW 11 119981408 missense probably damaging 1.00
R6966:Baiap2 UTSW 11 120006405 nonsense probably null
R7252:Baiap2 UTSW 11 120003039 missense probably benign
R8288:Baiap2 UTSW 11 119997639 missense probably damaging 1.00
RF005:Baiap2 UTSW 11 119996529 missense possibly damaging 0.89
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-06-07