Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4480001:Cntnap3'

554882

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

PIT4480001 (G1)

Quality Score

145.008

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64757210 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 919 (F919S)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: F919S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: F919S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 93.3%
3x: 90.7%
10x: 83.8%
20x: 69.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,283,752	M4475V	probably benign	Het
Actn3	G	A	19: 4,867,577	Q413*	probably null	Het
Ahnak2	C	T	12: 112,773,924	S1238N	possibly damaging	Het
Arsk	T	C	13: 76,062,365	E521G	probably damaging	Het
Baiap2	A	G	11: 119,997,087	T356A	probably benign	Het
Baz1b	G	A	5: 135,217,965	R756H	probably damaging	Het
Celsr1	G	A	15: 86,032,414	P453S	probably damaging	Het
Cep41	G	A	6: 30,658,413	P196S	probably damaging	Het
Cln5	T	A	14: 103,071,778	Y89*	probably null	Het
Cntrl	C	T	2: 35,155,428	H1383Y	probably damaging	Het
Cobl	A	G	11: 12,253,592	S1037P	probably benign	Het
Col17a1	A	T	19: 47,671,374	S380T	probably benign	Het
Dagla	A	T	19: 10,260,658	S323T	probably benign	Het
Dicer1	G	T	12: 104,696,544	Q1593K	probably benign	Het
Dnah6	T	C	6: 73,101,880	I2367V	probably benign	Het
Emc1	T	C	4: 139,359,277	S184P	possibly damaging	Het
Eps8l1	G	A	7: 4,471,415	S295N	probably benign	Het
Erbb4	A	T	1: 68,075,543	M914K	probably damaging	Het
Eva1a	A	G	6: 82,091,803	E37G	probably damaging	Het
Fam49b	G	A	15: 63,956,641	T11I	probably benign	Het
Fyco1	G	T	9: 123,828,650	Y820*	probably null	Het
Gipr	T	C	7: 19,162,934	Y137C	probably damaging	Het
Gm5414	A	G	15: 101,627,746	V148A	probably damaging	Het
Gpn1	T	C	5: 31,497,341	V79A	probably damaging	Het
Grk2	G	A	19: 4,287,409	R617C	possibly damaging	Het
Inpp4b	A	C	8: 82,046,267	E730A	probably damaging	Het
Inpp5f	C	T	7: 128,685,134	T579I	probably benign	Het
Kif15	A	T	9: 123,011,543	M1201L	probably benign	Het
Ltbp3	A	G	19: 5,751,226	N631S	possibly damaging	Het
Mdh1	G	A	11: 21,558,538	S268L	probably damaging	Het
Mgat4e	T	A	1: 134,541,365	T314S	possibly damaging	Het
Nsd1	A	G	13: 55,213,918	Q233R	probably benign	Het
Olfr1141	T	C	2: 87,753,783	D70G	possibly damaging	Het
Olfr738	T	C	14: 50,413,915	F124L	probably benign	Het
Paqr5	T	A	9: 61,956,156	I295L	probably benign	Het
Peg10	C	T	6: 4,756,560	H379Y	unknown	Het
Phtf2	A	T	5: 20,813,244	I33N	probably damaging	Het
Plcb2	T	C	2: 118,723,496	M115V	probably benign	Het
Ppp2r3a	A	G	9: 101,126,377	Y431H	possibly damaging	Het
Prph2	GT	G	17: 46,911,113		probably null	Het
Psmd1	C	T	1: 86,128,238	P774L	probably damaging	Het
Ranbp17	A	T	11: 33,297,340		probably null	Het
Rptn	A	G	3: 93,397,670	D770G	possibly damaging	Het
Serac1	A	G	17: 6,050,812	L439P	probably damaging	Het
Slitrk6	TTTTAGTCTGTTCTACCAACACCTT	TTT	14: 110,749,825		probably null	Het
Sox6	T	C	7: 115,597,509	I295M	probably benign	Het
Sulf1	T	A	1: 12,859,413	D301E	probably benign	Het
Tas2r117	G	A	6: 132,803,051	V51I	possibly damaging	Het
Tbx2	C	T	11: 85,834,735	R171C	probably damaging	Het
Tgfbr1	A	G	4: 47,402,955	I320V	probably benign	Het
Tjp3	C	A	10: 81,279,257	G396W	probably damaging	Het
Tmprss2	T	C	16: 97,599,260	N4D	possibly damaging	Het
Tnfaip3	T	C	10: 19,007,323	N165D	probably benign	Het
Tnfrsf21	A	T	17: 43,037,911	Y138F	probably benign	Het
Utp4	T	C	8: 106,906,185	S267P	probably benign	Het
Wnk1	A	T	6: 119,963,367	L803*	probably null	Het
Zbbx	T	A	3: 75,136,487	D35V	probably damaging	Het
Zscan12	T	G	13: 21,368,574	N189K	possibly damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTAACACTAGGGAATGGAGAC -3'
(R):5'- CCTTGTGAGCTCACTATACAGTCAC -3'

Sequencing Primer
(F):5'- CTGCTAGCTTTGCCAAATTGG -3'
(R):5'- ATACAGTCACCGACTCCCTTTAATG -3'

Posted On

2019-06-07