Incidental Mutation 'PIT4480001:Olfr738'
ID554884
Institutional Source Beutler Lab
Gene Symbol Olfr738
Ensembl Gene ENSMUSG00000094692
Gene Nameolfactory receptor 738
SynonymsGA_x6K02T2PMLR-6110726-6111661, MOR106-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50407568-50415438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50413915 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 124 (F124L)
Ref Sequence ENSEMBL: ENSMUSP00000150067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058972] [ENSMUST00000214320] [ENSMUST00000214853] [ENSMUST00000216949]
Predicted Effect probably benign
Transcript: ENSMUST00000058972
AA Change: F124L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000059540
Gene: ENSMUSG00000094692
AA Change: F124L

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.5e-50 PFAM
Pfam:7TM_GPCR_Srsx 39 309 1.3e-5 PFAM
Pfam:7tm_1 45 294 6.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214320
AA Change: F124L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214853
AA Change: F124L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216949
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Olfr738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Olfr738 APN 14 50414453 missense probably benign
IGL01935:Olfr738 APN 14 50413555 missense probably benign
IGL02431:Olfr738 APN 14 50413769 missense probably damaging 1.00
BB008:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
BB018:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
R0620:Olfr738 UTSW 14 50413697 missense probably benign 0.20
R1445:Olfr738 UTSW 14 50414401 missense probably damaging 1.00
R1831:Olfr738 UTSW 14 50414201 unclassified probably null
R1915:Olfr738 UTSW 14 50414341 missense probably damaging 1.00
R4748:Olfr738 UTSW 14 50413876 missense possibly damaging 0.77
R5301:Olfr738 UTSW 14 50413573 missense probably benign 0.09
R5767:Olfr738 UTSW 14 50413778 missense possibly damaging 0.55
R5831:Olfr738 UTSW 14 50413982 unclassified probably null
R6173:Olfr738 UTSW 14 50414197 missense possibly damaging 0.70
R6176:Olfr738 UTSW 14 50414390 missense probably damaging 1.00
R7356:Olfr738 UTSW 14 50413702 missense probably damaging 1.00
R7678:Olfr738 UTSW 14 50414014 missense probably damaging 0.98
R7931:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCATCATATGTGCTGTGTGC -3'
(R):5'- GGAAGTGGTCTATAATTCTGGATCCAC -3'

Sequencing Primer
(F):5'- GTGCTATGATAAGAAACTTCACAGCC -3'
(R):5'- TCTGGATCCACAGAAGGACATTTG -3'
Posted On2019-06-07