Incidental Mutation 'PIT4480001:Celsr1'
ID554888
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Namecadherin, EGF LAG seven-pass G-type receptor 1
Synonymscrash, Crsh, Scy
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85898929-86033777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86032414 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 453 (P453S)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
Predicted Effect probably damaging
Transcript: ENSMUST00000016172
AA Change: P453S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: P453S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85931345 missense probably benign 0.04
IGL00519:Celsr1 APN 15 86030836 missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85922235 missense probably damaging 1.00
IGL01303:Celsr1 APN 15 86030491 missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85926190 missense probably benign 0.35
IGL01910:Celsr1 APN 15 85929895 missense probably benign
IGL01931:Celsr1 APN 15 85907660 missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85963223 missense probably benign 0.35
IGL02090:Celsr1 APN 15 85907721 missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85979004 missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85929907 missense probably benign 0.01
IGL02413:Celsr1 APN 15 86031226 missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85941136 missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85900688 utr 3 prime probably benign
IGL02508:Celsr1 APN 15 86030617 nonsense probably null
IGL02899:Celsr1 APN 15 86031726 missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85901472 missense probably benign
IGL03212:Celsr1 APN 15 85930677 missense probably benign 0.04
P0028:Celsr1 UTSW 15 85922235 missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85900937 missense possibly damaging 0.87
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85929419 missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 86030762 missense probably benign 0.02
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85902864 missense probably benign 0.00
R0570:Celsr1 UTSW 15 85903365 missense probably benign 0.18
R0611:Celsr1 UTSW 15 85932323 missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85901597 missense probably benign
R0792:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R0943:Celsr1 UTSW 15 85903288 missense probably damaging 1.00
R0989:Celsr1 UTSW 15 86031279 missense probably benign 0.39
R1118:Celsr1 UTSW 15 86032047 missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R1239:Celsr1 UTSW 15 85979146 missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1522:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R1662:Celsr1 UTSW 15 86031062 missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85932457 missense probably benign 0.00
R1795:Celsr1 UTSW 15 86030323 missense probably damaging 0.99
R1799:Celsr1 UTSW 15 86032685 missense probably damaging 1.00
R1858:Celsr1 UTSW 15 86032759 missense probably damaging 1.00
R2040:Celsr1 UTSW 15 86032887 missense probably damaging 1.00
R2050:Celsr1 UTSW 15 86030547 missense probably benign 0.02
R2131:Celsr1 UTSW 15 85963223 missense probably benign 0.35
R2132:Celsr1 UTSW 15 86031967 missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85979230 missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85916723 missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 86031807 missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85978827 missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85963133 missense probably benign 0.00
R4414:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4416:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85916756 missense probably benign 0.35
R4666:Celsr1 UTSW 15 86030494 missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85932460 missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85906029 critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85937953 missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85937911 missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85939134 missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85932384 missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85930546 missense probably benign
R5310:Celsr1 UTSW 15 85926222 missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85931282 missense probably benign 0.00
R5639:Celsr1 UTSW 15 86030767 missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85941264 missense probably benign 0.27
R5778:Celsr1 UTSW 15 86032955 missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85904014 missense probably benign 0.02
R5915:Celsr1 UTSW 15 85937975 missense probably benign
R5915:Celsr1 UTSW 15 86030349 missense probably damaging 0.96
R5932:Celsr1 UTSW 15 86032704 missense probably damaging 1.00
R5950:Celsr1 UTSW 15 86032500 missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85919038 splice site probably null
R6050:Celsr1 UTSW 15 85930611 missense probably benign 0.00
R6117:Celsr1 UTSW 15 85932411 missense probably benign 0.04
R6178:Celsr1 UTSW 15 85901021 missense probably benign 0.08
R6186:Celsr1 UTSW 15 85921193 missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85916687 missense probably benign 0.25
R6307:Celsr1 UTSW 15 85928330 missense probably benign
R6320:Celsr1 UTSW 15 85900959 missense probably benign 0.13
R6349:Celsr1 UTSW 15 86031684 missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85978920 missense probably benign 0.07
R6607:Celsr1 UTSW 15 85963285 missense probably benign
R6615:Celsr1 UTSW 15 85902114 critical splice donor site probably null
R6661:Celsr1 UTSW 15 85918934 missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85905914 critical splice donor site probably null
R6743:Celsr1 UTSW 15 85907598 missense probably damaging 0.96
R6746:Celsr1 UTSW 15 86031495 missense probably damaging 1.00
R6772:Celsr1 UTSW 15 86030782 missense probably benign
R6838:Celsr1 UTSW 15 85939194 missense probably benign
R6886:Celsr1 UTSW 15 86031654 missense probably benign 0.00
R7030:Celsr1 UTSW 15 85905478 missense probably damaging 0.99
R7060:Celsr1 UTSW 15 86032655 missense probably benign 0.07
R7080:Celsr1 UTSW 15 85932451 missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 86033008 missense probably damaging 0.99
R7357:Celsr1 UTSW 15 86030514 missense probably benign 0.00
R7371:Celsr1 UTSW 15 86030674 missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85907673 missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 86033392 missense probably benign
R7491:Celsr1 UTSW 15 86032518 missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85929872 missense probably benign 0.00
R7685:Celsr1 UTSW 15 85978732 nonsense probably null
R7741:Celsr1 UTSW 15 85979102 missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85932409 missense probably benign
R8073:Celsr1 UTSW 15 85939155 missense probably benign 0.00
R8099:Celsr1 UTSW 15 86031600 missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85902889 missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85979235 missense probably benign 0.00
R8289:Celsr1 UTSW 15 86033085 nonsense probably null
R8290:Celsr1 UTSW 15 86033085 nonsense probably null
R8292:Celsr1 UTSW 15 85907618 missense possibly damaging 0.90
Z1176:Celsr1 UTSW 15 85963100 missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85978851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTATGGCTGCATTCTGC -3'
(R):5'- GCAGTCTGAGTATCGAGAGC -3'

Sequencing Primer
(F):5'- GCTGCATTCTGCCCCTGG -3'
(R):5'- GGTTCTGACCATCCGTGC -3'
Posted On2019-06-07