Incidental Mutation 'PIT4480001:Actn3'
ID554895
Institutional Source Beutler Lab
Gene Symbol Actn3
Ensembl Gene ENSMUSG00000006457
Gene Nameactinin alpha 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4861223-4877909 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 4867577 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 413 (Q413*)
Ref Sequence ENSEMBL: ENSMUSP00000006626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626]
Predicted Effect probably null
Transcript: ENSMUST00000006626
AA Change: Q413*
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457
AA Change: Q413*

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase mitochondria density and a shift from anaerobic to aerobic metabolism in fast muscle fiber that is associated with increased aerobic capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Actn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
ballooned UTSW 19 4871848 missense probably damaging 1.00
R0128:Actn3 UTSW 19 4871615 missense probably damaging 1.00
R1174:Actn3 UTSW 19 4864756 missense probably damaging 1.00
R1181:Actn3 UTSW 19 4872610 missense probably benign 0.07
R1239:Actn3 UTSW 19 4865455 unclassified probably benign
R1445:Actn3 UTSW 19 4865455 unclassified probably benign
R1698:Actn3 UTSW 19 4862207 missense possibly damaging 0.55
R2127:Actn3 UTSW 19 4871675 missense probably damaging 1.00
R4017:Actn3 UTSW 19 4867546 missense possibly damaging 0.95
R4293:Actn3 UTSW 19 4865440 missense probably benign 0.09
R4482:Actn3 UTSW 19 4863408 critical splice donor site probably null
R4840:Actn3 UTSW 19 4864511 missense probably damaging 1.00
R4868:Actn3 UTSW 19 4864454 missense probably benign 0.24
R5152:Actn3 UTSW 19 4863544 missense probably damaging 1.00
R5349:Actn3 UTSW 19 4867958 missense possibly damaging 0.94
R5420:Actn3 UTSW 19 4865344 frame shift probably null
R5448:Actn3 UTSW 19 4863211 missense possibly damaging 0.94
R5563:Actn3 UTSW 19 4872316 missense probably damaging 1.00
R5753:Actn3 UTSW 19 4864567 critical splice acceptor site probably null
R6457:Actn3 UTSW 19 4871848 missense probably damaging 1.00
R7236:Actn3 UTSW 19 4871616 missense probably benign 0.07
R7470:Actn3 UTSW 19 4867814 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGCATAGCAACAAGTCAGGATG -3'
(R):5'- TTCCCATCTGCATAACGGGTG -3'

Sequencing Primer
(F):5'- GACTCTGCCTGGTCTACATAAGG -3'
(R):5'- TGAACCGTGATGGAGGCCAC -3'
Posted On2019-06-07