Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4480001:Actn3'

554895

Institutional Source

Beutler Lab

Gene Symbol

Actn3

Ensembl Gene

ENSMUSG00000006457

Gene Name

actinin alpha 3

Synonyms

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.406) question?

Stock #

PIT4480001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4861223-4877909 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 4867577 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 413 (Q413*)

Ref Sequence

ENSEMBL: ENSMUSP00000006626 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006626]

Predicted Effect

probably null
Transcript: ENSMUST00000006626
AA Change: Q413*

SMART Domains

Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457
AA Change: Q413*

Domain	Start	End	E-Value	Type
low complexity region	8	30	N/A	INTRINSIC
CH	46	146	1.4e-23	SMART
CH	159	258	4.83e-27	SMART
low complexity region	261	272	N/A	INTRINSIC
Pfam:Spectrin	287	397	5.5e-15	PFAM
SPEC	410	511	3.78e-23	SMART
SPEC	525	632	2.37e-6	SMART
Pfam:Spectrin	643	746	4.1e-15	PFAM
EFh	763	791	7.93e-1	SMART
EFh	799	827	5.96e-1	SMART
efhand_Ca_insen	830	896	2.29e-34	SMART

Coding Region Coverage

1x: 93.3%
3x: 90.7%
10x: 83.8%
20x: 69.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase mitochondria density and a shift from anaerobic to aerobic metabolism in fast muscle fiber that is associated with increased aerobic capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,283,752	M4475V	probably benign	Het
Ahnak2	C	T	12: 112,773,924	S1238N	possibly damaging	Het
Arsk	T	C	13: 76,062,365	E521G	probably damaging	Het
Baiap2	A	G	11: 119,997,087	T356A	probably benign	Het
Baz1b	G	A	5: 135,217,965	R756H	probably damaging	Het
Celsr1	G	A	15: 86,032,414	P453S	probably damaging	Het
Cep41	G	A	6: 30,658,413	P196S	probably damaging	Het
Cln5	T	A	14: 103,071,778	Y89*	probably null	Het
Cntnap3	A	G	13: 64,757,210	F919S	probably damaging	Het
Cntrl	C	T	2: 35,155,428	H1383Y	probably damaging	Het
Cobl	A	G	11: 12,253,592	S1037P	probably benign	Het
Col17a1	A	T	19: 47,671,374	S380T	probably benign	Het
Dagla	A	T	19: 10,260,658	S323T	probably benign	Het
Dicer1	G	T	12: 104,696,544	Q1593K	probably benign	Het
Dnah6	T	C	6: 73,101,880	I2367V	probably benign	Het
Emc1	T	C	4: 139,359,277	S184P	possibly damaging	Het
Eps8l1	G	A	7: 4,471,415	S295N	probably benign	Het
Erbb4	A	T	1: 68,075,543	M914K	probably damaging	Het
Eva1a	A	G	6: 82,091,803	E37G	probably damaging	Het
Fam49b	G	A	15: 63,956,641	T11I	probably benign	Het
Fyco1	G	T	9: 123,828,650	Y820*	probably null	Het
Gipr	T	C	7: 19,162,934	Y137C	probably damaging	Het
Gm5414	A	G	15: 101,627,746	V148A	probably damaging	Het
Gpn1	T	C	5: 31,497,341	V79A	probably damaging	Het
Grk2	G	A	19: 4,287,409	R617C	possibly damaging	Het
Inpp4b	A	C	8: 82,046,267	E730A	probably damaging	Het
Inpp5f	C	T	7: 128,685,134	T579I	probably benign	Het
Kif15	A	T	9: 123,011,543	M1201L	probably benign	Het
Ltbp3	A	G	19: 5,751,226	N631S	possibly damaging	Het
Mdh1	G	A	11: 21,558,538	S268L	probably damaging	Het
Mgat4e	T	A	1: 134,541,365	T314S	possibly damaging	Het
Nsd1	A	G	13: 55,213,918	Q233R	probably benign	Het
Olfr1141	T	C	2: 87,753,783	D70G	possibly damaging	Het
Olfr738	T	C	14: 50,413,915	F124L	probably benign	Het
Paqr5	T	A	9: 61,956,156	I295L	probably benign	Het
Peg10	C	T	6: 4,756,560	H379Y	unknown	Het
Phtf2	A	T	5: 20,813,244	I33N	probably damaging	Het
Plcb2	T	C	2: 118,723,496	M115V	probably benign	Het
Ppp2r3a	A	G	9: 101,126,377	Y431H	possibly damaging	Het
Prph2	GT	G	17: 46,911,113		probably null	Het
Psmd1	C	T	1: 86,128,238	P774L	probably damaging	Het
Ranbp17	A	T	11: 33,297,340		probably null	Het
Rptn	A	G	3: 93,397,670	D770G	possibly damaging	Het
Serac1	A	G	17: 6,050,812	L439P	probably damaging	Het
Slitrk6	TTTTAGTCTGTTCTACCAACACCTT	TTT	14: 110,749,825		probably null	Het
Sox6	T	C	7: 115,597,509	I295M	probably benign	Het
Sulf1	T	A	1: 12,859,413	D301E	probably benign	Het
Tas2r117	G	A	6: 132,803,051	V51I	possibly damaging	Het
Tbx2	C	T	11: 85,834,735	R171C	probably damaging	Het
Tgfbr1	A	G	4: 47,402,955	I320V	probably benign	Het
Tjp3	C	A	10: 81,279,257	G396W	probably damaging	Het
Tmprss2	T	C	16: 97,599,260	N4D	possibly damaging	Het
Tnfaip3	T	C	10: 19,007,323	N165D	probably benign	Het
Tnfrsf21	A	T	17: 43,037,911	Y138F	probably benign	Het
Utp4	T	C	8: 106,906,185	S267P	probably benign	Het
Wnk1	A	T	6: 119,963,367	L803*	probably null	Het
Zbbx	T	A	3: 75,136,487	D35V	probably damaging	Het
Zscan12	T	G	13: 21,368,574	N189K	possibly damaging	Het

Other mutations in Actn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
ballooned	UTSW	19	4871848	missense	probably damaging	1.00
R0128:Actn3	UTSW	19	4871615	missense	probably damaging	1.00
R1174:Actn3	UTSW	19	4864756	missense	probably damaging	1.00
R1181:Actn3	UTSW	19	4872610	missense	probably benign	0.07
R1239:Actn3	UTSW	19	4865455	unclassified	probably benign
R1445:Actn3	UTSW	19	4865455	unclassified	probably benign
R1698:Actn3	UTSW	19	4862207	missense	possibly damaging	0.55
R2127:Actn3	UTSW	19	4871675	missense	probably damaging	1.00
R4017:Actn3	UTSW	19	4867546	missense	possibly damaging	0.95
R4293:Actn3	UTSW	19	4865440	missense	probably benign	0.09
R4482:Actn3	UTSW	19	4863408	critical splice donor site	probably null
R4840:Actn3	UTSW	19	4864511	missense	probably damaging	1.00
R4868:Actn3	UTSW	19	4864454	missense	probably benign	0.24
R5152:Actn3	UTSW	19	4863544	missense	probably damaging	1.00
R5349:Actn3	UTSW	19	4867958	missense	possibly damaging	0.94
R5420:Actn3	UTSW	19	4865344	frame shift	probably null
R5448:Actn3	UTSW	19	4863211	missense	possibly damaging	0.94
R5563:Actn3	UTSW	19	4872316	missense	probably damaging	1.00
R5753:Actn3	UTSW	19	4864567	critical splice acceptor site	probably null
R6457:Actn3	UTSW	19	4871848	missense	probably damaging	1.00
R7236:Actn3	UTSW	19	4871616	missense	probably benign	0.07
R7470:Actn3	UTSW	19	4867814	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTGCATAGCAACAAGTCAGGATG -3'
(R):5'- TTCCCATCTGCATAACGGGTG -3'

Sequencing Primer
(F):5'- GACTCTGCCTGGTCTACATAAGG -3'
(R):5'- TGAACCGTGATGGAGGCCAC -3'

Posted On

2019-06-07