Incidental Mutation 'PIT4480001:Actn3'
ID554895
Institutional Source Beutler Lab
Gene Symbol Actn3
Ensembl Gene ENSMUSG00000006457
Gene Nameactinin alpha 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4861223-4877909 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 4867577 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 413 (Q413*)
Ref Sequence ENSEMBL: ENSMUSP00000006626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626]
Predicted Effect probably null
Transcript: ENSMUST00000006626
AA Change: Q413*
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457
AA Change: Q413*

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase mitochondria density and a shift from anaerobic to aerobic metabolism in fast muscle fiber that is associated with increased aerobic capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Actn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
ballooned UTSW 19 4871848 missense probably damaging 1.00
bamboozled UTSW 19 4871655 missense probably damaging 1.00
confused UTSW 19 4865440 missense probably benign 0.09
R0128:Actn3 UTSW 19 4871615 missense probably damaging 1.00
R1174:Actn3 UTSW 19 4864756 missense probably damaging 1.00
R1181:Actn3 UTSW 19 4872610 missense probably benign 0.07
R1239:Actn3 UTSW 19 4865455 unclassified probably benign
R1445:Actn3 UTSW 19 4865455 unclassified probably benign
R1698:Actn3 UTSW 19 4862207 missense possibly damaging 0.55
R2127:Actn3 UTSW 19 4871675 missense probably damaging 1.00
R4017:Actn3 UTSW 19 4867546 missense possibly damaging 0.95
R4293:Actn3 UTSW 19 4865440 missense probably benign 0.09
R4482:Actn3 UTSW 19 4863408 critical splice donor site probably null
R4840:Actn3 UTSW 19 4864511 missense probably damaging 1.00
R4868:Actn3 UTSW 19 4864454 missense probably benign 0.24
R5152:Actn3 UTSW 19 4863544 missense probably damaging 1.00
R5349:Actn3 UTSW 19 4867958 missense possibly damaging 0.94
R5420:Actn3 UTSW 19 4865344 frame shift probably null
R5448:Actn3 UTSW 19 4863211 missense possibly damaging 0.94
R5563:Actn3 UTSW 19 4872316 missense probably damaging 1.00
R5753:Actn3 UTSW 19 4864567 critical splice acceptor site probably null
R6457:Actn3 UTSW 19 4871848 missense probably damaging 1.00
R7236:Actn3 UTSW 19 4871616 missense probably benign 0.07
R7470:Actn3 UTSW 19 4867814 missense possibly damaging 0.87
R7980:Actn3 UTSW 19 4867922 missense probably damaging 1.00
R8232:Actn3 UTSW 19 4871655 missense probably damaging 1.00
R8348:Actn3 UTSW 19 4865333 missense possibly damaging 0.61
R8421:Actn3 UTSW 19 4861713 missense probably benign
R8754:Actn3 UTSW 19 4863460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCATAGCAACAAGTCAGGATG -3'
(R):5'- TTCCCATCTGCATAACGGGTG -3'

Sequencing Primer
(F):5'- GACTCTGCCTGGTCTACATAAGG -3'
(R):5'- TGAACCGTGATGGAGGCCAC -3'
Posted On2019-06-07