Incidental Mutation 'PIT4377001:Acadl'
ID554901
Institutional Source Beutler Lab
Gene Symbol Acadl
Ensembl Gene ENSMUSG00000026003
Gene Nameacyl-Coenzyme A dehydrogenase, long-chain
SynonymsLCAD, C79855
Accession Numbers

Genbank: NM_007381.3; Ensembl: ENSMUST00000027153, ENSMUST00000139208

Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #PIT4377001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location66830839-66863277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66838405 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 329 (T329M)
Ref Sequence ENSEMBL: ENSMUSP00000027153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027153]
Predicted Effect probably damaging
Transcript: ENSMUST00000027153
AA Change: T329M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027153
Gene: ENSMUSG00000026003
AA Change: T329M

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 54 165 1.3e-33 PFAM
Pfam:Acyl-CoA_dh_M 169 266 9.2e-29 PFAM
Pfam:Acyl-CoA_dh_1 278 427 5.1e-44 PFAM
Pfam:Acyl-CoA_dh_2 293 416 3.4e-11 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C12- and C16-acylCoA. In mice, deficiency of this gene can cause sudden death, cardiomyopathy as well as fasting and cold intolerance. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutation of this gene results in reduced litter size, sudden death between 2-14 weeks of age, reduced serum glucose levels, lipid accumulation in the liver and heart, and cardiomyopathy. Heterozygous mutant animals exhibit reduced litter size. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Acadl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Acadl APN 1 66841705 missense probably damaging 0.97
IGL01983:Acadl APN 1 66841624 nonsense probably null
IGL02550:Acadl APN 1 66845166 critical splice donor site probably null
IGL02934:Acadl APN 1 66836975 missense probably benign 0.33
IGL03002:Acadl APN 1 66836969 missense probably benign 0.01
B6584:Acadl UTSW 1 66848473 splice site probably benign
R0426:Acadl UTSW 1 66841646 missense probably damaging 0.99
R0639:Acadl UTSW 1 66857408 missense probably benign
R1264:Acadl UTSW 1 66857553 missense probably benign 0.00
R1589:Acadl UTSW 1 66853223 missense probably benign 0.04
R2066:Acadl UTSW 1 66841746 splice site probably null
R3735:Acadl UTSW 1 66853289 missense probably benign 0.41
R4646:Acadl UTSW 1 66831443 missense probably benign 0.00
R5690:Acadl UTSW 1 66853286 missense probably damaging 1.00
R6185:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7686:Acadl UTSW 1 66848398 critical splice donor site probably null
R7699:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7700:Acadl UTSW 1 66838363 missense possibly damaging 0.72
R7858:Acadl UTSW 1 66838324 missense probably benign 0.11
R7941:Acadl UTSW 1 66838324 missense probably benign 0.11
R8052:Acadl UTSW 1 66853178 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGTAATCTGGACCAACACTGCAC -3'
(R):5'- GGCGCTCACACATTAAATCATG -3'

Sequencing Primer
(F):5'- CTGCACTTTAACTATAGGAATGCGCG -3'
(R):5'- ATTAGAGGTGCTGAGTGGA -3'
Posted On2019-06-07