Incidental Mutation 'PIT4377001:Qsox2'
List |< first << previous [record 48 of 62] next >> last >|
ID554904
Institutional Source Beutler Lab
Gene Symbol Qsox2
Ensembl Gene ENSMUSG00000036327
Gene Namequiescin Q6 sulfhydryl oxidase 2
SynonymsQSOX2, Qscn6l1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #PIT4377001 (G1)
Quality Score150.008
Status Not validated
Chromosome2
Chromosomal Location26208637-26237525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 26220912 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 147 (D147A)
Ref Sequence ENSEMBL: ENSMUSP00000088807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036187] [ENSMUST00000091263]
Predicted Effect probably damaging
Transcript: ENSMUST00000036187
AA Change: D312A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037128
Gene: ENSMUSG00000036327
AA Change: D312A

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Thioredoxin 59 166 1.7e-15 PFAM
low complexity region 295 310 N/A INTRINSIC
Blast:HOX 355 398 6e-14 BLAST
Pfam:Evr1_Alr 424 525 3.4e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091263
AA Change: D147A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088807
Gene: ENSMUSG00000036327
AA Change: D147A

DomainStartEndE-ValueType
low complexity region 130 145 N/A INTRINSIC
Blast:HOX 190 233 1e-13 BLAST
Pfam:Evr1_Alr 259 361 2.4e-30 PFAM
transmembrane domain 490 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the sulfhydryl oxidase protein family. Members of this family catalyze formation of disulfide bonds. A similar protein in humans may sensitize neuroblastoma cells to interferon gamma-induced cell death. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Qsox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Qsox2 APN 2 26222255 missense probably benign 0.15
IGL01067:Qsox2 APN 2 26228396 missense probably damaging 1.00
IGL01105:Qsox2 APN 2 26209685 missense probably benign 0.00
IGL02420:Qsox2 APN 2 26220719 missense probably benign 0.07
IGL03323:Qsox2 APN 2 26220979 missense probably benign
PIT4677001:Qsox2 UTSW 2 26222308 missense probably damaging 1.00
PIT4687001:Qsox2 UTSW 2 26222288 missense possibly damaging 0.93
R0559:Qsox2 UTSW 2 26214157 missense probably benign 0.05
R0594:Qsox2 UTSW 2 26214044 missense probably damaging 1.00
R1055:Qsox2 UTSW 2 26214125 missense probably damaging 1.00
R1657:Qsox2 UTSW 2 26220747 nonsense probably null
R1727:Qsox2 UTSW 2 26220958 missense probably benign 0.00
R1746:Qsox2 UTSW 2 26220638 missense probably benign
R1858:Qsox2 UTSW 2 26214062 missense probably damaging 1.00
R2309:Qsox2 UTSW 2 26228433 missense possibly damaging 0.61
R5291:Qsox2 UTSW 2 26217698 missense probably damaging 1.00
R5298:Qsox2 UTSW 2 26214062 missense probably damaging 0.96
R5524:Qsox2 UTSW 2 26217687 missense probably damaging 1.00
R5567:Qsox2 UTSW 2 26225218 start codon destroyed probably null
R5570:Qsox2 UTSW 2 26225218 start codon destroyed probably null
R5965:Qsox2 UTSW 2 26222221 missense probably benign 0.06
R6529:Qsox2 UTSW 2 26217741 missense probably damaging 1.00
R6957:Qsox2 UTSW 2 26217642 missense probably benign 0.40
R7185:Qsox2 UTSW 2 26220706 missense possibly damaging 0.63
R7250:Qsox2 UTSW 2 26228432 missense probably damaging 1.00
R7637:Qsox2 UTSW 2 26221020 missense probably damaging 1.00
Z1176:Qsox2 UTSW 2 26217666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGTCTGCAGTATACAGC -3'
(R):5'- AATGGCCAGTCTGTTCCAAGC -3'

Sequencing Primer
(F):5'- AGTATACAGCTTGGCCCTGAG -3'
(R):5'- CAAGCTATGGCCTGCAGAG -3'
Posted On2019-06-07