Incidental Mutation 'PIT4377001:Olfr1279'
List |< first << previous [record 44 of 62] next >> last >|
ID554906
Institutional Source Beutler Lab
Gene Symbol Olfr1279
Ensembl Gene ENSMUSG00000109813
Gene Nameolfactory receptor 1279
SynonymsMOR245-12, GA_x6K02T2Q125-72357646-72358581
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #PIT4377001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111300635-111309043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111306880 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 225 (V225D)
Ref Sequence ENSEMBL: ENSMUSP00000149972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090329] [ENSMUST00000213823] [ENSMUST00000216697]
Predicted Effect probably damaging
Transcript: ENSMUST00000090329
AA Change: V227D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087801
Gene: ENSMUSG00000109813
AA Change: V227D

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 36 300 3.2e-5 PFAM
Pfam:7tm_1 43 289 7.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213823
AA Change: V225D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216697
AA Change: V225D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Olfr1279
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1279 APN 2 111306621 missense probably benign 0.19
IGL01355:Olfr1279 APN 2 111307093 missense probably benign 0.00
IGL01864:Olfr1279 APN 2 111307055 missense probably damaging 1.00
IGL02160:Olfr1279 APN 2 111306798 missense probably benign 0.02
IGL02183:Olfr1279 APN 2 111306418 missense probably damaging 0.98
R0280:Olfr1279 UTSW 2 111307072 missense possibly damaging 0.48
R0636:Olfr1279 UTSW 2 111306412 missense probably benign 0.06
R0732:Olfr1279 UTSW 2 111306980 nonsense probably null
R1661:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R1665:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R2251:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2252:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2253:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2473:Olfr1279 UTSW 2 111306891 missense probably damaging 1.00
R3408:Olfr1279 UTSW 2 111306505 missense probably damaging 1.00
R5020:Olfr1279 UTSW 2 111306292 missense probably benign 0.01
R5634:Olfr1279 UTSW 2 111307092 missense probably benign
R5647:Olfr1279 UTSW 2 111307047 missense possibly damaging 0.67
R6782:Olfr1279 UTSW 2 111306745 missense probably damaging 1.00
R6911:Olfr1279 UTSW 2 111306273 missense probably benign 0.00
R7135:Olfr1279 UTSW 2 111307020 missense probably benign 0.05
R7167:Olfr1279 UTSW 2 111306448 missense probably benign 0.10
R7452:Olfr1279 UTSW 2 111306921 missense probably damaging 1.00
R7563:Olfr1279 UTSW 2 111306789 missense probably benign 0.00
R7582:Olfr1279 UTSW 2 111306448 missense probably damaging 0.97
X0021:Olfr1279 UTSW 2 111306588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTCCTAACAAAGTGGACAG -3'
(R):5'- GCTACAAACAGCCCTTTTGC -3'

Sequencing Primer
(F):5'- CAAAGTGGACAGCTTTTACTGCGAC -3'
(R):5'- ACAAACAGCCCTTTTGCTTAATC -3'
Posted On2019-06-07