Incidental Mutation 'R0602:Cspg4'
ID55491
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Namechondroitin sulfate proteoglycan 4
SynonymsAN2, 4732461B14Rik, NG2
MMRRC Submission 038791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0602 (G1)
Quality Score206
Status Validated
Chromosome9
Chromosomal Location56865033-56899870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56888017 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1012 (F1012S)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
Predicted Effect probably damaging
Transcript: ENSMUST00000035661
AA Change: F1012S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: F1012S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215666
Meta Mutation Damage Score 0.5670 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.7%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik T C 7: 137,376,361 probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Arih1 A G 9: 59,394,871 probably benign Het
Bcl9 T C 3: 97,205,786 I1118V probably benign Het
Cap1 T C 4: 122,872,409 E12G probably damaging Het
Ccr2 A G 9: 124,106,621 I313V probably benign Het
Cd1d2 T C 3: 86,987,803 S161P probably benign Het
Cd226 C T 18: 89,269,011 T311I probably benign Het
Col25a1 A G 3: 130,575,414 probably null Het
Dnah7b A G 1: 46,324,842 M3541V probably damaging Het
Erbb2 G A 11: 98,434,271 V852M probably damaging Het
Fer1l6 A C 15: 58,577,945 T667P probably damaging Het
Gal3st2c A G 1: 94,009,179 Y282C probably damaging Het
Glp1r T C 17: 30,909,227 L60P probably benign Het
Gm8251 T A 1: 44,059,967 K657I possibly damaging Het
Gtf2h2 A G 13: 100,469,025 V358A probably benign Het
Hephl1 T A 9: 15,089,051 I302F probably damaging Het
Hist2h2aa1 T C 3: 96,245,550 probably benign Het
Lgi2 T C 5: 52,554,423 D185G probably damaging Het
Lrtm1 T C 14: 29,022,222 probably benign Het
Megf10 T G 18: 57,262,100 D511E probably damaging Het
Myo5c A G 9: 75,266,196 probably null Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Ola1 A G 2: 73,093,712 Y368H probably damaging Het
Olfr1497 T C 19: 13,794,662 probably null Het
Olfr1505 A G 19: 13,919,781 T254A probably benign Het
Olfr593 A C 7: 103,212,580 H229P possibly damaging Het
Panx1 A G 9: 15,010,204 L125P probably damaging Het
Pappa2 A G 1: 158,763,055 probably benign Het
Parp6 A G 9: 59,649,365 probably benign Het
Pomgnt2 A G 9: 121,982,273 Y481H probably benign Het
Ppp4c A G 7: 126,789,082 probably benign Het
Prl8a8 T A 13: 27,508,550 probably benign Het
Prpf40b C A 15: 99,304,471 A70E unknown Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Ptprc C T 1: 138,089,485 probably benign Het
Rgs22 T C 15: 36,139,872 probably benign Het
Rpgrip1 A G 14: 52,133,856 E344G possibly damaging Het
Sgca A T 11: 94,963,235 I383N possibly damaging Het
Sgms2 T A 3: 131,325,107 probably null Het
Slc9b1 C A 3: 135,397,755 Q549K probably benign Het
Smc4 G C 3: 69,009,538 A187P probably damaging Het
Smco1 A G 16: 32,273,244 S47G probably damaging Het
Sobp T A 10: 43,022,389 E400V probably damaging Het
Stil T A 4: 115,024,423 probably benign Het
Sult3a2 A T 10: 33,782,048 M23K probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcof1 C A 18: 60,833,533 G329W probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Vmn1r171 G T 7: 23,633,177 V276L probably benign Het
Vps13b T C 15: 35,422,368 L158P probably damaging Het
Vps54 A G 11: 21,306,434 I634M possibly damaging Het
Vwa8 T G 14: 79,020,620 S736R probably benign Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1670:Cspg4 UTSW 9 56897403 missense probably damaging 1.00
R1721:Cspg4 UTSW 9 56888743 missense probably damaging 0.98
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R1975:Cspg4 UTSW 9 56890478 missense probably damaging 1.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4779:Cspg4 UTSW 9 56885808 missense probably damaging 1.00
R4884:Cspg4 UTSW 9 56898069 missense probably benign 0.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6140:Cspg4 UTSW 9 56897224 missense probably benign 0.35
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6967:Cspg4 UTSW 9 56890136 missense possibly damaging 0.52
R6981:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
R7419:Cspg4 UTSW 9 56888443 missense possibly damaging 0.94
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCTCTTCGTCAAGAGTCTCAAC -3'
(R):5'- TCCTCCATAGCCACAATGCTGC -3'

Sequencing Primer
(F):5'- AGCGCCAGCTATCTCTATGAG -3'
(R):5'- CTGCCAAAGAGGAGGTCCTTG -3'
Posted On2013-07-11