Incidental Mutation 'PIT4377001:Fblim1'
ID554913
Institutional Source Beutler Lab
Gene Symbol Fblim1
Ensembl Gene ENSMUSG00000006219
Gene Namefilamin binding LIM protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4377001 (G1)
Quality Score182.009
Status Not validated
Chromosome4
Chromosomal Location141576062-141606096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141595409 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 21 (R21H)
Ref Sequence ENSEMBL: ENSMUSP00000006381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006381] [ENSMUST00000105784] [ENSMUST00000105785] [ENSMUST00000123150] [ENSMUST00000127455] [ENSMUST00000129602] [ENSMUST00000130181] [ENSMUST00000131317] [ENSMUST00000133874] [ENSMUST00000136831] [ENSMUST00000141518] [ENSMUST00000147764] [ENSMUST00000147785] [ENSMUST00000153189]
Predicted Effect probably damaging
Transcript: ENSMUST00000006381
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006381
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105784
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101410
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105785
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101411
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-7 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
LIM 184 237 6e-18 SMART
LIM 244 296 2.98e-13 SMART
LIM 304 365 3.32e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123150
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121037
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000127455
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120028
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-9 PDB
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129602
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118647
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-9 PDB
low complexity region 85 102 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130181
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115992
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 162 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131317
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116395
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 3e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000133874
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000136831
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116596
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000141518
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123669
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147764
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120600
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147785
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114313
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 5e-9 PDB
low complexity region 86 120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153189
AA Change: R21H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123322
Gene: ENSMUSG00000006219
AA Change: R21H

DomainStartEndE-ValueType
PDB:2K9U|B 1 24 1e-8 PDB
low complexity region 86 120 N/A INTRINSIC
low complexity region 162 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal filamin-binding domain, a central proline-rich domain, and, multiple C-terminal LIM domains. This protein localizes at cell junctions and may link cell adhesion structures to the actin cytoskeleton. This protein may be involved in the assembly and stabilization of actin-filaments and likely plays a role in modulating cell adhesion, cell morphology and cell motility. This protein also localizes to the nucleus and may affect cardiomyocyte differentiation after binding with the CSX/NKX2-5 transcription factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit severe osteopenia with decreased osteoblasts and increased osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Fblim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02634:Fblim1 APN 4 141583111 missense probably benign 0.43
IGL03036:Fblim1 APN 4 141583124 missense possibly damaging 0.65
IGL02802:Fblim1 UTSW 4 141590120 missense possibly damaging 0.90
R0840:Fblim1 UTSW 4 141581009 missense possibly damaging 0.88
R1793:Fblim1 UTSW 4 141595238 missense probably damaging 1.00
R1975:Fblim1 UTSW 4 141584864 missense probably damaging 1.00
R4829:Fblim1 UTSW 4 141584709 missense probably damaging 1.00
R6066:Fblim1 UTSW 4 141577909 missense probably damaging 1.00
R6101:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6126:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6127:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R6128:Fblim1 UTSW 4 141584722 missense probably damaging 1.00
R7525:Fblim1 UTSW 4 141590080 missense probably damaging 1.00
Z1176:Fblim1 UTSW 4 141595371 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGTCCTCGTCCCCTTAGAGATG -3'
(R):5'- GGGCCTGGGTATTTAGACAG -3'

Sequencing Primer
(F):5'- GAGATGCTCTCTTACCTCCATTGGAG -3'
(R):5'- ATTTAGACAGTGTCTTGTAGGAGAAG -3'
Posted On2019-06-07