Incidental Mutation 'PIT4377001:Gemin7'
ID554920
Institutional Source Beutler Lab
Gene Symbol Gemin7
Ensembl Gene ENSMUSG00000044709
Gene Namegem nuclear organelle associated protein 7
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #PIT4377001 (G1)
Quality Score218.009
Status Not validated
Chromosome7
Chromosomal Location19564946-19577595 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 19565317 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 118 (R118*)
Ref Sequence ENSEMBL: ENSMUSP00000055844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051364] [ENSMUST00000058444] [ENSMUST00000117222] [ENSMUST00000119912] [ENSMUST00000122055] [ENSMUST00000122127] [ENSMUST00000151646] [ENSMUST00000208826]
Predicted Effect probably null
Transcript: ENSMUST00000051364
AA Change: R118*
SMART Domains Protein: ENSMUSP00000055844
Gene: ENSMUSG00000044709
AA Change: R118*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058444
SMART Domains Protein: ENSMUSP00000060233
Gene: ENSMUSG00000051403

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
Blast:LRR 139 166 1e-9 BLAST
LRR 224 251 1.77e2 SMART
LRR 252 280 3.52e-1 SMART
LRR 281 308 8.27e-7 SMART
LRR 310 337 3.05e1 SMART
LRR 338 365 1.4e-4 SMART
LRR 366 393 1.56e-2 SMART
LRR 394 421 2.36e-2 SMART
low complexity region 504 540 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 596 628 N/A INTRINSIC
low complexity region 660 679 N/A INTRINSIC
low complexity region 696 702 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117222
AA Change: R118*
SMART Domains Protein: ENSMUSP00000113266
Gene: ENSMUSG00000044709
AA Change: R118*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119912
AA Change: R118*
SMART Domains Protein: ENSMUSP00000112742
Gene: ENSMUSG00000044709
AA Change: R118*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122055
AA Change: R118*
SMART Domains Protein: ENSMUSP00000113583
Gene: ENSMUSG00000044709
AA Change: R118*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122127
AA Change: R118*
SMART Domains Protein: ENSMUSP00000113709
Gene: ENSMUSG00000044709
AA Change: R118*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151646
SMART Domains Protein: ENSMUSP00000116207
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 81 7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208826
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the core SMN complex, which is required for pre-mRNA splicing in the nucleus. The encoded protein is found in the nucleoplasm, in nuclear "gems" (Gemini of Cajal bodies), and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Gemin7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02750:Gemin7 APN 7 19565419 missense probably null 1.00
R5020:Gemin7 UTSW 7 19565423 missense possibly damaging 0.61
R5896:Gemin7 UTSW 7 19565298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGAGTTCAAAGCCAGAGTTTG -3'
(R):5'- GACCATCCTGAGACCAGAAGTC -3'

Sequencing Primer
(F):5'- TCAAAGCCAGAGTTTGTTGGAG -3'
(R):5'- TCGGAGAAGGTCATATTCAAGATCCC -3'
Posted On2019-06-07