Incidental Mutation 'PIT4377001:Gramd1a'
ID554922
Institutional Source Beutler Lab
Gene Symbol Gramd1a
Ensembl Gene ENSMUSG00000001248
Gene NameGRAM domain containing 1A
SynonymsD7Bwg0611e, 1300003M23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #PIT4377001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location31130127-31155896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31143670 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 71 (I71N)
Ref Sequence ENSEMBL: ENSMUSP00000001280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001280] [ENSMUST00000085636] [ENSMUST00000185514] [ENSMUST00000186634] [ENSMUST00000186723] [ENSMUST00000187679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001280
AA Change: I71N

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001280
Gene: ENSMUSG00000001248
AA Change: I71N

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 520 7.3e-37 PFAM
low complexity region 531 542 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 606 628 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085636
AA Change: I71N

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082778
Gene: ENSMUSG00000001248
AA Change: I71N

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 500 1.1e-28 PFAM
low complexity region 514 528 N/A INTRINSIC
transmembrane domain 572 594 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185514
AA Change: I71N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139681
Gene: ENSMUSG00000001248
AA Change: I71N

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186634
AA Change: I71N

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140195
Gene: ENSMUSG00000001248
AA Change: I71N

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 8.9e-32 SMART
low complexity region 342 360 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000139709
Gene: ENSMUSG00000001248
AA Change: I152N

DomainStartEndE-ValueType
low complexity region 89 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:GRAM 174 208 1e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000187679
AA Change: I30N

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140674
Gene: ENSMUSG00000001248
AA Change: I30N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
GRAM 52 119 8.9e-32 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000206432
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Gramd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Gramd1a APN 7 31142568 missense probably damaging 0.99
IGL01627:Gramd1a APN 7 31139796 missense probably damaging 0.99
IGL01684:Gramd1a APN 7 31138905 missense possibly damaging 0.67
IGL01793:Gramd1a APN 7 31134413 critical splice donor site probably null
IGL01986:Gramd1a APN 7 31134009 missense possibly damaging 0.58
IGL02029:Gramd1a APN 7 31132824 missense possibly damaging 0.95
IGL02060:Gramd1a APN 7 31130571 nonsense probably null
IGL02569:Gramd1a APN 7 31130507 unclassified probably benign
IGL02606:Gramd1a APN 7 31134515 missense probably damaging 1.00
IGL02715:Gramd1a APN 7 31135854 missense probably damaging 1.00
IGL03253:Gramd1a APN 7 31139846 nonsense probably null
PIT4618001:Gramd1a UTSW 7 31132596 missense probably benign 0.00
R0179:Gramd1a UTSW 7 31142418 missense probably damaging 1.00
R0329:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0330:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0628:Gramd1a UTSW 7 31142624 missense probably damaging 1.00
R0834:Gramd1a UTSW 7 31138164 missense possibly damaging 0.94
R1421:Gramd1a UTSW 7 31142866 missense probably damaging 0.98
R1430:Gramd1a UTSW 7 31132786 missense probably damaging 0.97
R1682:Gramd1a UTSW 7 31142900 splice site probably null
R1703:Gramd1a UTSW 7 31139534 missense possibly damaging 0.96
R1822:Gramd1a UTSW 7 31142573 missense probably damaging 1.00
R2308:Gramd1a UTSW 7 31139790 missense probably damaging 0.97
R3861:Gramd1a UTSW 7 31135940 missense possibly damaging 0.90
R4184:Gramd1a UTSW 7 31132515 intron probably benign
R4908:Gramd1a UTSW 7 31138867 missense probably benign 0.27
R4978:Gramd1a UTSW 7 31132788 missense possibly damaging 0.74
R5723:Gramd1a UTSW 7 31134483 missense probably damaging 1.00
R5927:Gramd1a UTSW 7 31139821 missense probably benign 0.33
R6466:Gramd1a UTSW 7 31143796 missense probably benign
R6838:Gramd1a UTSW 7 31134504 missense probably benign 0.30
R7034:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7036:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7867:Gramd1a UTSW 7 31143567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCTTATGTATCGCCCAC -3'
(R):5'- AGGCTAATTTCTGCCCCTAACC -3'

Sequencing Primer
(F):5'- AACTGCTCTCTCTGGTCTGGAG -3'
(R):5'- CACTCTGGCCGGAGCTC -3'
Posted On2019-06-07