Incidental Mutation 'PIT4377001:Dgat2'
ID554923
Institutional Source Beutler Lab
Gene Symbol Dgat2
Ensembl Gene ENSMUSG00000030747
Gene Namediacylglycerol O-acyltransferase 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4377001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location99153658-99182719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99157135 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 285 (Y285C)
Ref Sequence ENSEMBL: ENSMUSP00000033001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033001] [ENSMUST00000207491] [ENSMUST00000208591]
Predicted Effect probably damaging
Transcript: ENSMUST00000033001
AA Change: Y285C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033001
Gene: ENSMUSG00000030747
AA Change: Y285C

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Pfam:DAGAT 92 388 5.3e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207491
Predicted Effect probably benign
Transcript: ENSMUST00000208591
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutant mice die shortly after birth due to inadequate substrates for energy and impaired skin barrier function leading to dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Dgat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0532:Dgat2 UTSW 7 99169781 missense possibly damaging 0.46
R1726:Dgat2 UTSW 7 99182416 missense possibly damaging 0.83
R2386:Dgat2 UTSW 7 99157093 missense possibly damaging 0.79
R3429:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3430:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3881:Dgat2 UTSW 7 99169743 nonsense probably null
R4279:Dgat2 UTSW 7 99164705 missense probably damaging 1.00
R4280:Dgat2 UTSW 7 99158997 missense probably damaging 1.00
R4719:Dgat2 UTSW 7 99158297 missense probably benign 0.01
R6019:Dgat2 UTSW 7 99154631 missense probably benign 0.13
R6152:Dgat2 UTSW 7 99164678 missense probably benign 0.20
R6868:Dgat2 UTSW 7 99158306 missense probably benign 0.00
R7143:Dgat2 UTSW 7 99157124 missense probably benign 0.00
R7362:Dgat2 UTSW 7 99154636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGATGTTCTCTGAGCTGG -3'
(R):5'- GCCATGAGGTGAATCTGTGC -3'

Sequencing Primer
(F):5'- ATGCTCAGGATGGCCTTCAAC -3'
(R):5'- AATCTGTGCCTGTGAGGAAG -3'
Posted On2019-06-07