Incidental Mutation 'PIT4377001:Dchs1'
ID554924
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Namedachsous cadherin related 1
Synonyms3110041P15Rik, C130033F22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4377001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105752990-105787654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105757588 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 2237 (R2237W)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
Predicted Effect probably damaging
Transcript: ENSMUST00000078482
AA Change: R2237W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: R2237W

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7438:Dchs1 UTSW 7 105754948 missense probably benign 0.30
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
R7604:Dchs1 UTSW 7 105765982 missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105759238 missense probably benign
R7821:Dchs1 UTSW 7 105765145 missense probably benign 0.00
R7834:Dchs1 UTSW 7 105765567 missense probably benign 0.39
R7841:Dchs1 UTSW 7 105762973 missense probably benign
R7913:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R7917:Dchs1 UTSW 7 105765567 missense probably benign 0.39
R7924:Dchs1 UTSW 7 105762973 missense probably benign
R7994:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105755188 missense probably benign 0.45
Z1177:Dchs1 UTSW 7 105757693 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105758551 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCTGTGGCCATCAGTACCAG -3'
(R):5'- AGCCAGGGTCAGCAATCTTC -3'

Sequencing Primer
(F):5'- TGGCCATCAGTACCAGCCTAG -3'
(R):5'- TCTTCTACACTCACCAGGTGGAAG -3'
Posted On2019-06-07