Incidental Mutation 'PIT4377001:Krt42'
ID 554941
Institutional Source Beutler Lab
Gene Symbol Krt42
Ensembl Gene ENSMUSG00000053654
Gene Name keratin 42
Synonyms Ka22, ecat6, K17n, 2410039E07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # PIT4377001 (G1)
Quality Score 197.009
Status Not validated
Chromosome 11
Chromosomal Location 100262882-100269871 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100263105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 442 (S442P)
Ref Sequence ENSEMBL: ENSMUSP00000017270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017270] [ENSMUST00000080893]
AlphaFold Q6IFX2
Predicted Effect probably damaging
Transcript: ENSMUST00000017270
AA Change: S442P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017270
Gene: ENSMUSG00000053654
AA Change: S442P

DomainStartEndE-ValueType
low complexity region 62 84 N/A INTRINSIC
Filament 93 404 5.58e-184 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080893
SMART Domains Protein: ENSMUSP00000079699
Gene: ENSMUSG00000035557

DomainStartEndE-ValueType
Filament 83 394 9.36e-177 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Krt42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Krt42 APN 11 100263341 missense possibly damaging 0.93
R0135:Krt42 UTSW 11 100263159 missense possibly damaging 0.95
R0535:Krt42 UTSW 11 100264586 missense probably damaging 1.00
R1169:Krt42 UTSW 11 100263345 critical splice acceptor site probably null
R1456:Krt42 UTSW 11 100269609 missense probably benign 0.00
R1456:Krt42 UTSW 11 100269610 missense probably benign 0.04
R1913:Krt42 UTSW 11 100267249 missense possibly damaging 0.78
R4655:Krt42 UTSW 11 100269845 missense probably damaging 0.99
R5527:Krt42 UTSW 11 100263295 unclassified probably benign
R6049:Krt42 UTSW 11 100267060 missense probably damaging 1.00
R6901:Krt42 UTSW 11 100269716 missense probably benign 0.00
R7748:Krt42 UTSW 11 100266966 missense probably damaging 1.00
R7979:Krt42 UTSW 11 100265039 missense possibly damaging 0.67
R8030:Krt42 UTSW 11 100265039 missense possibly damaging 0.67
R8031:Krt42 UTSW 11 100265039 missense possibly damaging 0.67
R8063:Krt42 UTSW 11 100265039 missense possibly damaging 0.67
R8108:Krt42 UTSW 11 100266957 missense probably benign 0.01
R9040:Krt42 UTSW 11 100267033 missense probably damaging 1.00
R9211:Krt42 UTSW 11 100265041 missense possibly damaging 0.52
R9265:Krt42 UTSW 11 100266982 missense probably damaging 1.00
Z1177:Krt42 UTSW 11 100267068 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGGATCAGACTTCTTCAAAGC -3'
(R):5'- CCCGAGAAGGTAAGAGTCTAATCC -3'

Sequencing Primer
(F):5'- AGCAATTTCTGGGGTCAACC -3'
(R):5'- GAAGGTAAGAGTCTAATCCTGTCCTG -3'
Posted On 2019-06-07