Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4377001:Mdga2'

554943

Institutional Source

Beutler Lab

Gene Symbol

Mdga2

Ensembl Gene

ENSMUSG00000034912

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 2

Synonyms

Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4377001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66466060-67222549 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66716695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 278 (Q278L)

Ref Sequence

ENSEMBL: ENSMUSP00000046761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]

AlphaFold

P60755

Predicted Effect

probably damaging
Transcript: ENSMUST00000037181
AA Change: Q278L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: Q278L

Domain	Start	End	E-Value	Type
IGc2	122	186	1.38e-15	SMART
IG	213	307	1.79e0	SMART
IGc2	324	386	1.56e-14	SMART
IGc2	419	493	4.43e-5	SMART
low complexity region	495	507	N/A	INTRINSIC
IGc2	525	591	1.97e-11	SMART
IG_like	621	687	2.5e0	SMART
Blast:FN3	707	795	4e-40	BLAST
MAM	812	990	3.4e-49	SMART
transmembrane domain	999	1021	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101379

SMART Domains

Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SCOP:d1cs6a1	40	72	2e-5	SMART
Blast:IG	47	72	9e-11	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: Q268L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	53	117	1.38e-15	SMART
IG	144	238	1.79e0	SMART
IGc2	255	317	1.56e-14	SMART
IGc2	350	424	4.43e-5	SMART
low complexity region	426	438	N/A	INTRINSIC
IGc2	456	522	1.97e-11	SMART
IG_like	552	618	2.5e0	SMART
Blast:FN3	638	726	3e-40	BLAST
MAM	736	914	1.38e-49	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000222167
AA Change: Q209L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223141
AA Change: Q209L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 92.9%
3x: 90.8%
10x: 85.9%
20x: 75.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	T	C	4: 39,451,129	C112R	possibly damaging	Het
Acadl	G	A	1: 66,838,405	T329M	probably damaging	Het
Adgrv1	A	G	13: 81,528,985	L1909P	probably damaging	Het
Aff3	A	C	1: 38,538,963	V31G	probably damaging	Het
Bag3	A	G	7: 128,545,717	D352G	probably damaging	Het
Bcas3	A	T	11: 85,495,842	T368S	probably damaging	Het
Bmp3	A	G	5: 98,879,749	I434V	unknown	Het
Casq1	T	A	1: 172,212,001	T336S	probably benign	Het
Cib2	T	G	9: 54,559,987	E11A	probably damaging	Het
Cttn	C	A	7: 144,440,096	E393D	possibly damaging	Het
Dchs1	G	A	7: 105,757,588	R2237W	probably damaging	Het
Dclre1a	C	T	19: 56,544,405	A586T	probably benign	Het
Defb1	C	A	8: 21,776,700	Q17K	possibly damaging	Het
Dgat2	T	C	7: 99,157,135	Y285C	probably damaging	Het
Dhx57	A	T	17: 80,263,975	F732Y	probably damaging	Het
Dock2	T	G	11: 34,721,008	D176A	probably benign	Het
Epha6	A	G	16: 60,205,552	I509T	probably damaging	Het
Fblim1	C	T	4: 141,595,409	R21H	probably damaging	Het
Fbxw20	T	A	9: 109,221,727	H371L	probably benign	Het
Foxa1	T	A	12: 57,542,781	I218F	probably damaging	Het
Fstl1	A	T	16: 37,815,805	I53F	probably benign	Het
Gdnf	A	G	15: 7,834,530	R141G	probably benign	Het
Gemin7	G	A	7: 19,565,317	R118*	probably null	Het
Gm43218	T	C	6: 70,240,581	T64A	probably benign	Het
Gnat3	G	A	5: 18,015,559	M243I		Het
Gramd1a	A	T	7: 31,143,670	I71N	possibly damaging	Het
Hist1h4k	C	G	13: 21,750,484	G8R	unknown	Het
Htt	A	T	5: 34,875,965	D1859V	probably benign	Het
Hyal1	T	C	9: 107,579,269	F415S	probably damaging	Het
Ighv1-47	T	C	12: 114,991,238	N74S	probably benign	Het
Igkv1-131	T	C	6: 67,766,208	R64G	probably benign	Het
Itgb1	T	A	8: 128,710,383	V95D	probably damaging	Het
Jak1	A	C	4: 101,179,551	N297K	probably benign	Het
Kcna4	T	A	2: 107,296,860	N646K	possibly damaging	Het
Krt42	A	G	11: 100,263,105	S442P	probably damaging	Het
Mcm3ap	G	A	10: 76,502,762	S1408N	possibly damaging	Het
Mkln1	C	T	6: 31,474,354	T410M	probably damaging	Het
Nav3	T	C	10: 109,716,605	E1792G	probably damaging	Het
Ndrg1	A	G	15: 66,948,439	C49R	probably benign	Het
Neurl4	A	G	11: 69,910,406	H1201R	probably benign	Het
Nfasc	T	C	1: 132,583,066	Y1073C	unknown	Het
Nrbp2	A	G	15: 76,087,096	Y253H	probably benign	Het
Olfr1279	T	A	2: 111,306,880	V225D	probably damaging	Het
Olfr1295	T	C	2: 111,565,211	T78A	probably damaging	Het
Olfr95	T	A	17: 37,211,089	I255F	probably benign	Het
Pcsk5	A	T	19: 17,439,102	C1661S	probably damaging	Het
Qsox2	T	G	2: 26,220,912	D147A	probably damaging	Het
Siglec15	T	A	18: 78,057,375		probably benign	Het
Skint5	T	A	4: 113,597,703	T1011S	unknown	Het
Slc9a2	A	G	1: 40,743,841	T422A	probably damaging	Het
Tert	C	T	13: 73,628,261	T377I	possibly damaging	Het
Tex15	T	A	8: 33,571,101	S186R	probably damaging	Het
Tgfb1	A	G	7: 25,696,918	D212G	probably benign	Het
Tnc	T	G	4: 64,017,736	D321A	probably damaging	Het
Topbp1	G	A	9: 103,309,889	E98K	possibly damaging	Het
Ugp2	C	A	11: 21,370,203	M1I	probably null	Het
Vipr2	G	A	12: 116,094,798	D112N	probably benign	Het
Vps13a	T	C	19: 16,740,901	E485G	probably damaging	Het
Vps37a	T	A	8: 40,537,046	I198N	possibly damaging	Het
Zbtb9	T	C	17: 26,974,761	V380A	probably damaging	Het
Zfhx4	G	C	3: 5,242,742	V343L	probably damaging	Het

Other mutations in Mdga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Mdga2	APN	12	66723109	missense	probably damaging	0.97
IGL01632:Mdga2	APN	12	66629898	splice site	probably benign
IGL01843:Mdga2	APN	12	66723131	critical splice acceptor site	probably null
IGL02230:Mdga2	APN	12	66655423	nonsense	probably null
IGL02348:Mdga2	APN	12	66550575	missense	probably damaging	1.00
IGL02473:Mdga2	APN	12	66550611	missense	possibly damaging	0.73
IGL02795:Mdga2	APN	12	66689432	missense	probably benign	0.00
IGL02901:Mdga2	APN	12	66797809	splice site	probably benign
IGL03373:Mdga2	APN	12	66716722	missense	probably damaging	0.99
PIT4362001:Mdga2	UTSW	12	66797768	missense	possibly damaging	0.83
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0110:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0218:Mdga2	UTSW	12	66655120	missense	probably damaging	1.00
R0450:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0801:Mdga2	UTSW	12	66486733	missense	probably damaging	1.00
R0847:Mdga2	UTSW	12	66723080	missense	probably damaging	1.00
R1056:Mdga2	UTSW	12	66723120	missense	probably damaging	0.97
R1086:Mdga2	UTSW	12	66506102	splice site	probably benign
R1335:Mdga2	UTSW	12	66716742	splice site	probably null
R1382:Mdga2	UTSW	12	66470916	missense	possibly damaging	0.68
R1490:Mdga2	UTSW	12	66797756	missense	probably benign	0.01
R1521:Mdga2	UTSW	12	66568926	missense	probably benign	0.00
R1556:Mdga2	UTSW	12	66550593	missense	possibly damaging	0.92
R1676:Mdga2	UTSW	12	66568772	missense	probably damaging	1.00
R1676:Mdga2	UTSW	12	66568773	nonsense	probably null
R1698:Mdga2	UTSW	12	66689335	missense	probably damaging	0.97
R1954:Mdga2	UTSW	12	66486708	splice site	probably benign
R2069:Mdga2	UTSW	12	66568917	nonsense	probably null
R2077:Mdga2	UTSW	12	66655362	missense	probably damaging	1.00
R2118:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R2146:Mdga2	UTSW	12	66868741	missense	probably damaging	1.00
R2158:Mdga2	UTSW	12	66689381	missense	possibly damaging	0.64
R2189:Mdga2	UTSW	12	66473196	splice site	probably null
R2293:Mdga2	UTSW	12	66568985	nonsense	probably null
R2886:Mdga2	UTSW	12	66506270	splice site	probably benign
R2960:Mdga2	UTSW	12	66629978	nonsense	probably null
R3937:Mdga2	UTSW	12	67221206	unclassified	probably benign
R4437:Mdga2	UTSW	12	66473198	splice site	probably null
R4514:Mdga2	UTSW	12	66716722	missense	probably damaging	0.99
R4693:Mdga2	UTSW	12	66797633	missense	possibly damaging	0.81
R4719:Mdga2	UTSW	12	66471001	unclassified	probably benign
R4744:Mdga2	UTSW	12	66797727	missense	probably benign	0.01
R4756:Mdga2	UTSW	12	66797653	missense	probably damaging	1.00
R4781:Mdga2	UTSW	12	66797622	splice site	probably null
R5022:Mdga2	UTSW	12	66470760	missense	possibly damaging	0.83
R5108:Mdga2	UTSW	12	66486741	missense	probably benign	0.43
R5479:Mdga2	UTSW	12	66655176	missense	probably damaging	1.00
R5710:Mdga2	UTSW	12	66506782	missense	probably damaging	1.00
R5816:Mdga2	UTSW	12	66655182	missense	probably damaging	1.00
R5822:Mdga2	UTSW	12	66655335	missense	probably damaging	1.00
R5996:Mdga2	UTSW	12	66797763	missense	probably benign	0.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6297:Mdga2	UTSW	12	66506253	missense	probably damaging	1.00
R6484:Mdga2	UTSW	12	66630069	missense	possibly damaging	0.90
R6830:Mdga2	UTSW	12	66723001	missense	probably damaging	1.00
R6912:Mdga2	UTSW	12	66506115	missense	probably benign	0.01
R6971:Mdga2	UTSW	12	66550561	missense	probably damaging	1.00
R7053:Mdga2	UTSW	12	66689384	missense	probably benign	0.41
R7069:Mdga2	UTSW	12	66486752	missense	probably benign	0.31
R7381:Mdga2	UTSW	12	66568896	missense	probably benign	0.44
R7474:Mdga2	UTSW	12	66486761	nonsense	probably null
R7559:Mdga2	UTSW	12	66473229	missense	probably damaging	1.00
R7581:Mdga2	UTSW	12	66506255	missense	probably damaging	0.99
R7596:Mdga2	UTSW	12	66506123	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689350	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689351	missense	possibly damaging	0.63
R7852:Mdga2	UTSW	12	66470950	missense	possibly damaging	0.66
R8144:Mdga2	UTSW	12	66655263	missense	probably damaging	1.00
R8319:Mdga2	UTSW	12	67221029	missense	unknown
R8715:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R8977:Mdga2	UTSW	12	66797635	missense	possibly damaging	0.88
R9138:Mdga2	UTSW	12	66568889	missense	possibly damaging	0.89
R9177:Mdga2	UTSW	12	66470707	missense	possibly damaging	0.66
R9223:Mdga2	UTSW	12	66568860	missense	possibly damaging	0.81
R9248:Mdga2	UTSW	12	66689452	missense	possibly damaging	0.87
R9264:Mdga2	UTSW	12	66513283	missense	probably damaging	1.00
R9381:Mdga2	UTSW	12	66550530	missense	possibly damaging	0.64
R9456:Mdga2	UTSW	12	66568758	missense	probably benign	0.44
R9633:Mdga2	UTSW	12	66689432	missense	probably benign	0.00
Z1176:Mdga2	UTSW	12	66689443	missense	probably damaging	1.00
Z1186:Mdga2	UTSW	12	66568953	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGCTATCAACTGGCCTATAAGAAG -3'
(R):5'- TCCCCTAGGAAGCAAGTTTG -3'

Sequencing Primer
(F):5'- AGTCTAAACGACACCATCT -3'
(R):5'- CCAGTATTATGCGTAAGTACAGTG -3'

Posted On

2019-06-07