Incidental Mutation 'PIT4377001:Vipr2'
ID554945
Institutional Source Beutler Lab
Gene Symbol Vipr2
Ensembl Gene ENSMUSG00000011171
Gene Namevasoactive intestinal peptide receptor 2
SynonymsVPAC2R, VPAC2, VIP receptor subtype 2, Vip2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #PIT4377001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location116077726-116146261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116094798 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 112 (D112N)
Ref Sequence ENSEMBL: ENSMUSP00000011315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011315]
Predicted Effect probably benign
Transcript: ENSMUST00000011315
AA Change: D112N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000011315
Gene: ENSMUSG00000011171
AA Change: D112N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 47 117 8.35e-25 SMART
Pfam:7tm_2 122 370 1.5e-81 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced delayed-type hypersensitivity (type IV) and reduced immediate-type hypersensitivity (type I). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Hist1h4k C G 13: 21,750,484 G8R unknown Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Vipr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Vipr2 APN 12 116138748 splice site probably null
IGL02233:Vipr2 APN 12 116094736 missense probably damaging 0.99
IGL02691:Vipr2 APN 12 116136229 missense probably benign 0.11
R0135:Vipr2 UTSW 12 116142827 missense probably benign 0.00
R0207:Vipr2 UTSW 12 116142882 missense probably damaging 1.00
R1389:Vipr2 UTSW 12 116137330 missense probably benign 0.01
R1560:Vipr2 UTSW 12 116094781 missense probably benign 0.18
R1575:Vipr2 UTSW 12 116144272 missense probably benign
R1696:Vipr2 UTSW 12 116139157 missense probably benign 0.13
R1970:Vipr2 UTSW 12 116136206 missense probably benign 0.01
R2010:Vipr2 UTSW 12 116122810 critical splice donor site probably null
R3873:Vipr2 UTSW 12 116136104 unclassified probably benign
R4713:Vipr2 UTSW 12 116080131 missense probably benign 0.00
R4953:Vipr2 UTSW 12 116144256 missense probably benign 0.07
R6041:Vipr2 UTSW 12 116142984 missense probably damaging 1.00
R6337:Vipr2 UTSW 12 116122743 nonsense probably null
R6902:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R6946:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R7763:Vipr2 UTSW 12 116122718 missense probably damaging 1.00
X0066:Vipr2 UTSW 12 116142945 splice site probably null
X0067:Vipr2 UTSW 12 116139172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTTCACTGGACCCTGTC -3'
(R):5'- AGTCGGCAAATCGCAAATGC -3'

Sequencing Primer
(F):5'- CCTGTCAGGGAGGTCTCAAG -3'
(R):5'- TGCCAGAGCATATCAGAGACC -3'
Posted On2019-06-07