Incidental Mutation 'PIT4377001:Hist1h4k'
ID554946
Institutional Source Beutler Lab
Gene Symbol Hist1h4k
Ensembl Gene ENSMUSG00000064288
Gene Namehistone cluster 1, H4k
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #PIT4377001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21750194-21750505 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 21750484 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 8 (G8R)
Ref Sequence ENSEMBL: ENSMUSP00000100048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074752] [ENSMUST00000091709] [ENSMUST00000102983]
Predicted Effect probably benign
Transcript: ENSMUST00000074752
SMART Domains Protein: ENSMUSP00000074310
Gene: ENSMUSG00000063021

DomainStartEndE-ValueType
H2A 3 123 1.22e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091709
SMART Domains Protein: ENSMUSP00000089301
Gene: ENSMUSG00000095217

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102983
AA Change: G8R
SMART Domains Protein: ENSMUSP00000100048
Gene: ENSMUSG00000064288
AA Change: G8R

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 C112R possibly damaging Het
Acadl G A 1: 66,838,405 T329M probably damaging Het
Adgrv1 A G 13: 81,528,985 L1909P probably damaging Het
Aff3 A C 1: 38,538,963 V31G probably damaging Het
Bag3 A G 7: 128,545,717 D352G probably damaging Het
Bcas3 A T 11: 85,495,842 T368S probably damaging Het
Bmp3 A G 5: 98,879,749 I434V unknown Het
Casq1 T A 1: 172,212,001 T336S probably benign Het
Cib2 T G 9: 54,559,987 E11A probably damaging Het
Cttn C A 7: 144,440,096 E393D possibly damaging Het
Dchs1 G A 7: 105,757,588 R2237W probably damaging Het
Dclre1a C T 19: 56,544,405 A586T probably benign Het
Defb1 C A 8: 21,776,700 Q17K possibly damaging Het
Dgat2 T C 7: 99,157,135 Y285C probably damaging Het
Dhx57 A T 17: 80,263,975 F732Y probably damaging Het
Dock2 T G 11: 34,721,008 D176A probably benign Het
Epha6 A G 16: 60,205,552 I509T probably damaging Het
Fblim1 C T 4: 141,595,409 R21H probably damaging Het
Fbxw20 T A 9: 109,221,727 H371L probably benign Het
Foxa1 T A 12: 57,542,781 I218F probably damaging Het
Fstl1 A T 16: 37,815,805 I53F probably benign Het
Gdnf A G 15: 7,834,530 R141G probably benign Het
Gemin7 G A 7: 19,565,317 R118* probably null Het
Gm43218 T C 6: 70,240,581 T64A probably benign Het
Gnat3 G A 5: 18,015,559 M243I Het
Gramd1a A T 7: 31,143,670 I71N possibly damaging Het
Htt A T 5: 34,875,965 D1859V probably benign Het
Hyal1 T C 9: 107,579,269 F415S probably damaging Het
Ighv1-47 T C 12: 114,991,238 N74S probably benign Het
Igkv1-131 T C 6: 67,766,208 R64G probably benign Het
Itgb1 T A 8: 128,710,383 V95D probably damaging Het
Jak1 A C 4: 101,179,551 N297K probably benign Het
Kcna4 T A 2: 107,296,860 N646K possibly damaging Het
Krt42 A G 11: 100,263,105 S442P probably damaging Het
Mcm3ap G A 10: 76,502,762 S1408N possibly damaging Het
Mdga2 T A 12: 66,716,695 Q278L probably damaging Het
Mkln1 C T 6: 31,474,354 T410M probably damaging Het
Nav3 T C 10: 109,716,605 E1792G probably damaging Het
Ndrg1 A G 15: 66,948,439 C49R probably benign Het
Neurl4 A G 11: 69,910,406 H1201R probably benign Het
Nfasc T C 1: 132,583,066 Y1073C unknown Het
Nrbp2 A G 15: 76,087,096 Y253H probably benign Het
Olfr1279 T A 2: 111,306,880 V225D probably damaging Het
Olfr1295 T C 2: 111,565,211 T78A probably damaging Het
Olfr95 T A 17: 37,211,089 I255F probably benign Het
Pcsk5 A T 19: 17,439,102 C1661S probably damaging Het
Qsox2 T G 2: 26,220,912 D147A probably damaging Het
Siglec15 T A 18: 78,057,375 probably benign Het
Skint5 T A 4: 113,597,703 T1011S unknown Het
Slc9a2 A G 1: 40,743,841 T422A probably damaging Het
Tert C T 13: 73,628,261 T377I possibly damaging Het
Tex15 T A 8: 33,571,101 S186R probably damaging Het
Tgfb1 A G 7: 25,696,918 D212G probably benign Het
Tnc T G 4: 64,017,736 D321A probably damaging Het
Topbp1 G A 9: 103,309,889 E98K possibly damaging Het
Ugp2 C A 11: 21,370,203 M1I probably null Het
Vipr2 G A 12: 116,094,798 D112N probably benign Het
Vps13a T C 19: 16,740,901 E485G probably damaging Het
Vps37a T A 8: 40,537,046 I198N possibly damaging Het
Zbtb9 T C 17: 26,974,761 V380A probably damaging Het
Zfhx4 G C 3: 5,242,742 V343L probably damaging Het
Other mutations in Hist1h4k
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1931:Hist1h4k UTSW 13 21750512 unclassified probably null
R4032:Hist1h4k UTSW 13 21750418 missense possibly damaging 0.58
R4445:Hist1h4k UTSW 13 21750343 missense possibly damaging 0.64
R6699:Hist1h4k UTSW 13 21750504 start codon destroyed probably null
R6838:Hist1h4k UTSW 13 21750205 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTCCAGGAACACCTTCAGC -3'
(R):5'- GAGGAGCTAGTTCCCTCAGAAAG -3'

Sequencing Primer
(F):5'- GGAACACCTTCAGCACACCG -3'
(R):5'- TAGTTCCCTCAGAAAGCTCGG -3'
Posted On2019-06-07