Incidental Mutation 'PIT4378001:Wdr75'
ID 554961
Institutional Source Beutler Lab
Gene Symbol Wdr75
Ensembl Gene ENSMUSG00000025995
Gene Name WD repeat domain 75
Synonyms 1300003A18Rik, 2410118I19Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # PIT4378001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 45834326-45862779 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45859333 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 677 (T677A)
Ref Sequence ENSEMBL: ENSMUSP00000027139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027139]
AlphaFold Q3U821
Predicted Effect probably damaging
Transcript: ENSMUST00000027139
AA Change: T677A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027139
Gene: ENSMUSG00000025995
AA Change: T677A

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
WD40 185 230 1.61e-3 SMART
WD40 239 275 4.44e0 SMART
WD40 278 317 7.67e0 SMART
low complexity region 405 417 N/A INTRINSIC
WD40 431 473 7.67e0 SMART
WD40 486 524 3.08e0 SMART
WD40 527 568 3.96e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186651
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik T C 11: 59,099,802 (GRCm39) V100A probably benign Het
Adamtsl1 T C 4: 86,117,601 (GRCm39) V188A possibly damaging Het
Aldh6a1 T C 12: 84,488,646 (GRCm39) D80G probably benign Het
Ankrd50 T C 3: 38,509,412 (GRCm39) Q62R possibly damaging Het
Aopep T C 13: 63,163,021 (GRCm39) L14P probably damaging Het
Arrdc1 T A 2: 24,816,645 (GRCm39) Y177F probably damaging Het
Asap1 C T 15: 64,007,697 (GRCm39) R384Q probably damaging Het
Atxn2l A T 7: 126,096,443 (GRCm39) V433D probably benign Het
Bbs1 G A 19: 4,941,703 (GRCm39) A529V probably benign Het
Bbx G A 16: 50,100,836 (GRCm39) R20* probably null Het
Bend5 T C 4: 111,288,304 (GRCm39) V106A probably benign Het
C1galt1 A G 6: 7,863,944 (GRCm39) N8S probably benign Het
Cdc42ep1 G A 15: 78,733,880 (GRCm39) D327N possibly damaging Het
Cep162 A G 9: 87,099,198 (GRCm39) S767P probably benign Het
Cep43 T C 17: 8,401,105 (GRCm39) S209P probably damaging Het
Csmd1 T C 8: 15,945,728 (GRCm39) T3562A probably damaging Het
Dnah7a A G 1: 53,570,362 (GRCm39) S1815P probably damaging Het
Ei24 A T 9: 36,697,320 (GRCm39) L136Q probably damaging Het
Extl2 T G 3: 115,804,339 (GRCm39) M1R probably null Het
Fat3 T C 9: 16,288,104 (GRCm39) E473G probably benign Het
Fcgbpl1 G A 7: 27,853,889 (GRCm39) D1618N possibly damaging Het
Fhip1a A G 3: 85,637,858 (GRCm39) L147P probably damaging Het
G6pc3 T A 11: 102,080,827 (GRCm39) W26R probably damaging Het
Hc T A 2: 34,921,876 (GRCm39) Y610F probably benign Het
Hecw1 T C 13: 14,552,368 (GRCm39) D77G probably damaging Het
Hgf T C 5: 16,816,860 (GRCm39) V497A probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hyou1 A C 9: 44,302,148 (GRCm39) D968A probably benign Het
Jmjd1c T A 10: 67,065,692 (GRCm39) S1525T probably damaging Het
Kcnc4 G A 3: 107,354,879 (GRCm39) T523I probably benign Het
Kcng1 C T 2: 168,104,604 (GRCm39) C414Y probably damaging Het
Klhdc10 T C 6: 30,447,411 (GRCm39) I204T probably damaging Het
Krt18 A T 15: 101,938,358 (GRCm39) T194S probably benign Het
Krt76 A C 15: 101,800,842 (GRCm39) N151K probably damaging Het
Krtap31-2 A G 11: 99,827,542 (GRCm39) T125A possibly damaging Het
Lama5 A G 2: 179,831,238 (GRCm39) V1807A possibly damaging Het
Lats1 T G 10: 7,581,369 (GRCm39) V718G probably damaging Het
Mef2b A G 8: 70,616,910 (GRCm39) K4E probably damaging Het
Mertk T C 2: 128,624,537 (GRCm39) probably null Het
Mroh8 A G 2: 157,070,620 (GRCm39) V577A possibly damaging Het
Mtcl1 T G 17: 66,745,274 (GRCm39) N381T probably damaging Het
Nfyc T A 4: 120,647,688 (GRCm39) probably null Het
Nol4 C A 18: 23,172,933 (GRCm39) W56L probably damaging Het
Notch2 A T 3: 98,050,272 (GRCm39) D1849V probably damaging Het
Or10ad1 G A 15: 98,105,452 (GRCm39) T271I probably damaging Het
Or10j7 T C 1: 173,011,381 (GRCm39) T207A probably benign Het
Or14c45 A T 7: 86,176,306 (GRCm39) T114S possibly damaging Het
Or4n4b T C 14: 50,536,355 (GRCm39) N137S probably benign Het
Or5an10 A G 19: 12,276,076 (GRCm39) M140T probably damaging Het
Or7g28 T A 9: 19,272,471 (GRCm39) Y60F probably damaging Het
Or8s5 A G 15: 98,238,153 (GRCm39) V239A possibly damaging Het
Oxr1 G A 15: 41,664,978 (GRCm39) V138I probably benign Het
Pars2 A G 4: 106,511,490 (GRCm39) E424G possibly damaging Het
Peli2 C A 14: 48,405,726 (GRCm39) Y50* probably null Het
Plag1 T A 4: 3,905,492 (GRCm39) H66L probably benign Het
Psme4 T C 11: 30,771,079 (GRCm39) probably benign Het
Robo1 A T 16: 72,801,423 (GRCm39) S1016C probably damaging Het
Rrbp1 A G 2: 143,816,460 (GRCm39) V723A probably benign Het
Sgip1 C A 4: 102,778,280 (GRCm39) D292E unknown Het
Skint4 T A 4: 111,944,232 (GRCm39) C23S probably benign Het
Slc22a28 A C 19: 8,049,279 (GRCm39) S323R probably damaging Het
Slc41a3 A G 6: 90,617,891 (GRCm39) T306A probably benign Het
Spata13 A G 14: 60,987,445 (GRCm39) M868V probably damaging Het
Spata6 T G 4: 111,603,378 (GRCm39) I31S possibly damaging Het
Sycp3 A T 10: 88,302,366 (GRCm39) K119* probably null Het
Tlk2 T A 11: 105,172,046 (GRCm39) S739T unknown Het
Trim10 T C 17: 37,188,020 (GRCm39) V412A probably damaging Het
Ttc3 T A 16: 94,211,765 (GRCm39) F377I probably benign Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Unc5a T C 13: 55,143,681 (GRCm39) Y122H possibly damaging Het
Uncx C T 5: 139,530,377 (GRCm39) R152* probably null Het
Usp44 A G 10: 93,681,517 (GRCm39) probably benign Het
Vamp2 A C 11: 68,980,564 (GRCm39) D44A probably benign Het
Vmn2r83 A G 10: 79,304,849 (GRCm39) T20A probably benign Het
Vmn2r84 A T 10: 130,221,784 (GRCm39) I812N probably damaging Het
Vrtn T G 12: 84,695,943 (GRCm39) L231R probably damaging Het
Xylt1 C A 7: 117,148,100 (GRCm39) S221R possibly damaging Het
Zscan22 A G 7: 12,637,983 (GRCm39) E125G possibly damaging Het
Zxdc A T 6: 90,350,698 (GRCm39) H383L probably damaging Het
Other mutations in Wdr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Wdr75 APN 1 45,841,235 (GRCm39) missense probably benign 0.02
IGL00711:Wdr75 APN 1 45,862,541 (GRCm39) missense probably benign 0.00
IGL01350:Wdr75 APN 1 45,857,420 (GRCm39) nonsense probably null
IGL02135:Wdr75 APN 1 45,856,608 (GRCm39) splice site probably null
IGL02135:Wdr75 APN 1 45,853,723 (GRCm39) missense probably damaging 1.00
BB008:Wdr75 UTSW 1 45,858,795 (GRCm39) missense probably benign 0.00
BB018:Wdr75 UTSW 1 45,858,795 (GRCm39) missense probably benign 0.00
FR4976:Wdr75 UTSW 1 45,862,564 (GRCm39) utr 3 prime probably benign
R0060:Wdr75 UTSW 1 45,855,777 (GRCm39) missense probably benign 0.16
R0463:Wdr75 UTSW 1 45,858,762 (GRCm39) missense probably damaging 1.00
R0963:Wdr75 UTSW 1 45,856,470 (GRCm39) missense probably benign 0.07
R1364:Wdr75 UTSW 1 45,838,222 (GRCm39) missense probably benign 0.01
R1382:Wdr75 UTSW 1 45,856,471 (GRCm39) missense probably damaging 1.00
R1562:Wdr75 UTSW 1 45,843,030 (GRCm39) splice site probably null
R1909:Wdr75 UTSW 1 45,862,563 (GRCm39) missense probably benign 0.00
R2968:Wdr75 UTSW 1 45,856,501 (GRCm39) missense probably damaging 1.00
R3972:Wdr75 UTSW 1 45,861,714 (GRCm39) missense probably benign 0.01
R4372:Wdr75 UTSW 1 45,845,833 (GRCm39) unclassified probably benign
R4720:Wdr75 UTSW 1 45,861,645 (GRCm39) missense probably benign 0.05
R4922:Wdr75 UTSW 1 45,855,638 (GRCm39) missense probably damaging 1.00
R5201:Wdr75 UTSW 1 45,862,519 (GRCm39) missense probably benign 0.00
R5242:Wdr75 UTSW 1 45,856,487 (GRCm39) nonsense probably null
R5255:Wdr75 UTSW 1 45,838,277 (GRCm39) missense probably damaging 1.00
R5320:Wdr75 UTSW 1 45,838,211 (GRCm39) missense probably damaging 0.96
R5450:Wdr75 UTSW 1 45,851,324 (GRCm39) missense probably benign 0.26
R6072:Wdr75 UTSW 1 45,838,211 (GRCm39) missense probably damaging 0.96
R6147:Wdr75 UTSW 1 45,858,698 (GRCm39) missense probably benign 0.00
R6341:Wdr75 UTSW 1 45,841,291 (GRCm39) critical splice donor site probably null
R6629:Wdr75 UTSW 1 45,851,216 (GRCm39) missense probably damaging 1.00
R6646:Wdr75 UTSW 1 45,838,247 (GRCm39) missense probably damaging 1.00
R6722:Wdr75 UTSW 1 45,844,512 (GRCm39) splice site probably null
R6750:Wdr75 UTSW 1 45,856,539 (GRCm39) missense probably damaging 1.00
R6850:Wdr75 UTSW 1 45,853,758 (GRCm39) missense probably benign 0.00
R6851:Wdr75 UTSW 1 45,862,587 (GRCm39) missense probably benign
R7172:Wdr75 UTSW 1 45,838,294 (GRCm39) missense probably damaging 1.00
R7248:Wdr75 UTSW 1 45,856,560 (GRCm39) missense probably damaging 1.00
R7809:Wdr75 UTSW 1 45,862,596 (GRCm39) missense probably benign 0.00
R7931:Wdr75 UTSW 1 45,858,795 (GRCm39) missense probably benign 0.00
R7937:Wdr75 UTSW 1 45,858,799 (GRCm39) missense probably benign 0.17
R8171:Wdr75 UTSW 1 45,861,706 (GRCm39) missense probably benign 0.00
R8218:Wdr75 UTSW 1 45,857,342 (GRCm39) missense probably damaging 1.00
R8724:Wdr75 UTSW 1 45,856,560 (GRCm39) missense probably damaging 1.00
R8900:Wdr75 UTSW 1 45,838,287 (GRCm39) missense probably damaging 0.99
R9400:Wdr75 UTSW 1 45,843,064 (GRCm39) missense probably damaging 1.00
R9665:Wdr75 UTSW 1 45,843,013 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGTCTTGTAACTCCCACAGAAC -3'
(R):5'- TGGCTAAGTCTTTAAAACACGAGAC -3'

Sequencing Primer
(F):5'- TGTAACTCCCACAGAACCTTTC -3'
(R):5'- CTTATTCTCTAAACGTGAGGGAGGAG -3'
Posted On 2019-06-07