Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4378001:Mertk'

554968

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

PIT4378001 (G1)

Quality Score

209.009

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 128782617 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably null
Transcript: ENSMUST00000014505

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Coding Region Coverage

1x: 93.1%
3x: 90.8%
10x: 85.0%
20x: 72.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,015,207	L14P	probably damaging	Het
2310033P09Rik	T	C	11: 59,208,976	V100A	probably benign	Het
9530053A07Rik	G	A	7: 28,154,464	D1618N	possibly damaging	Het
Adamtsl1	T	C	4: 86,199,364	V188A	possibly damaging	Het
Aldh6a1	T	C	12: 84,441,872	D80G	probably benign	Het
Ankrd50	T	C	3: 38,455,263	Q62R	possibly damaging	Het
Arrdc1	T	A	2: 24,926,633	Y177F	probably damaging	Het
Asap1	C	T	15: 64,135,848	R384Q	probably damaging	Het
Atxn2l	A	T	7: 126,497,271	V433D	probably benign	Het
Bbs1	G	A	19: 4,891,675	A529V	probably benign	Het
Bbx	G	A	16: 50,280,473	R20*	probably null	Het
Bend5	T	C	4: 111,431,107	V106A	probably benign	Het
C1galt1	A	G	6: 7,863,944	N8S	probably benign	Het
Cdc42ep1	G	A	15: 78,849,680	D327N	possibly damaging	Het
Cep162	A	G	9: 87,217,145	S767P	probably benign	Het
Csmd1	T	C	8: 15,895,728	T3562A	probably damaging	Het
Dnah7a	A	G	1: 53,531,203	S1815P	probably damaging	Het
Ei24	A	T	9: 36,786,024	L136Q	probably damaging	Het
Extl2	T	G	3: 116,010,690	M1R	probably null	Het
Fam160a1	A	G	3: 85,730,551	L147P	probably damaging	Het
Fat3	T	C	9: 16,376,808	E473G	probably benign	Het
Fgfr1op	T	C	17: 8,182,273	S209P	probably damaging	Het
G6pc3	T	A	11: 102,190,001	W26R	probably damaging	Het
Hc	T	A	2: 35,031,864	Y610F	probably benign	Het
Hecw1	T	C	13: 14,377,783	D77G	probably damaging	Het
Hgf	T	C	5: 16,611,862	V497A	probably damaging	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Hyou1	A	C	9: 44,390,851	D968A	probably benign	Het
Jmjd1c	T	A	10: 67,229,913	S1525T	probably damaging	Het
Kcnc4	G	A	3: 107,447,563	T523I	probably benign	Het
Kcng1	C	T	2: 168,262,684	C414Y	probably damaging	Het
Klhdc10	T	C	6: 30,447,412	I204T	probably damaging	Het
Krt18	A	T	15: 102,029,923	T194S	probably benign	Het
Krt76	A	C	15: 101,892,407	N151K	probably damaging	Het
Krtap31-2	A	G	11: 99,936,716	T125A	possibly damaging	Het
Lama5	A	G	2: 180,189,445	V1807A	possibly damaging	Het
Lats1	T	G	10: 7,705,605	V718G	probably damaging	Het
Mef2b	A	G	8: 70,164,260	K4E	probably damaging	Het
Mroh8	A	G	2: 157,228,700	V577A	possibly damaging	Het
Mtcl1	T	G	17: 66,438,279	N381T	probably damaging	Het
Nfyc	T	A	4: 120,790,491		probably null	Het
Nol4	C	A	18: 23,039,876	W56L	probably damaging	Het
Notch2	A	T	3: 98,142,956	D1849V	probably damaging	Het
Olfr1406	T	C	1: 173,183,814	T207A	probably benign	Het
Olfr1436	A	G	19: 12,298,712	M140T	probably damaging	Het
Olfr284	A	G	15: 98,340,272	V239A	possibly damaging	Het
Olfr287	G	A	15: 98,207,571	T271I	probably damaging	Het
Olfr297	A	T	7: 86,527,098	T114S	possibly damaging	Het
Olfr733	T	C	14: 50,298,898	N137S	probably benign	Het
Olfr846	T	A	9: 19,361,175	Y60F	probably damaging	Het
Oxr1	G	A	15: 41,801,582	V138I	probably benign	Het
Pars2	A	G	4: 106,654,293	E424G	possibly damaging	Het
Peli2	C	A	14: 48,168,269	Y50*	probably null	Het
Plag1	T	A	4: 3,905,492	H66L	probably benign	Het
Psme4	T	C	11: 30,821,079		probably benign	Het
Robo1	A	T	16: 73,004,535	S1016C	probably damaging	Het
Rrbp1	A	G	2: 143,974,540	V723A	probably benign	Het
Sgip1	C	A	4: 102,921,083	D292E	unknown	Het
Skint4	T	A	4: 112,087,035	C23S	probably benign	Het
Slc22a28	A	C	19: 8,071,914	S323R	probably damaging	Het
Slc41a3	A	G	6: 90,640,909	T306A	probably benign	Het
Spata13	A	G	14: 60,749,996	M868V	probably damaging	Het
Spata6	T	G	4: 111,746,181	I31S	possibly damaging	Het
Sycp3	A	T	10: 88,466,504	K119*	probably null	Het
Tlk2	T	A	11: 105,281,220	S739T	unknown	Het
Trim10	T	C	17: 36,877,128	V412A	probably damaging	Het
Ttc3	T	A	16: 94,410,906	F377I	probably benign	Het
Uck1	T	A	2: 32,256,034	H283L	probably damaging	Het
Unc5a	T	C	13: 54,995,868	Y122H	possibly damaging	Het
Uncx	C	T	5: 139,544,622	R152*	probably null	Het
Usp44	A	G	10: 93,845,655		probably benign	Het
Vamp2	A	C	11: 69,089,738	D44A	probably benign	Het
Vmn2r83	A	G	10: 79,469,015	T20A	probably benign	Het
Vmn2r84	A	T	10: 130,385,915	I812N	probably damaging	Het
Vrtn	T	G	12: 84,649,169	L231R	probably damaging	Het
Wdr75	A	G	1: 45,820,173	T677A	probably damaging	Het
Xylt1	C	A	7: 117,548,865	S221R	possibly damaging	Het
Zscan22	A	G	7: 12,904,056	E125G	possibly damaging	Het
Zxdc	A	T	6: 90,373,716	H383L	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGTGCTGTTCCTGGTCCC -3'
(R):5'- GGTTAACTCCATCAGCACCC -3'

Sequencing Primer
(F):5'- CCCTGAGCTGACCTTGTTGG -3'
(R):5'- CAGGAAACACAAACCCGGTTTTACTC -3'

Posted On

2019-06-07