Incidental Mutation 'PIT4378001:Fhip1a'
ID 554974
Institutional Source Beutler Lab
Gene Symbol Fhip1a
Ensembl Gene ENSMUSG00000051000
Gene Name FHF complex subunit HOOK interacting protein 1A
Synonyms 9930021J17Rik, Fam160a1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4378001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 85567370-85653516 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85637858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 147 (L147P)
Ref Sequence ENSEMBL: ENSMUSP00000091700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094148] [ENSMUST00000118408] [ENSMUST00000119077] [ENSMUST00000154148]
AlphaFold Q505K2
Predicted Effect probably damaging
Transcript: ENSMUST00000094148
AA Change: L147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091700
Gene: ENSMUSG00000051000
AA Change: L147P

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.2e-102 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118408
AA Change: L147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113235
Gene: ENSMUSG00000051000
AA Change: L147P

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.1e-98 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119077
SMART Domains Protein: ENSMUSP00000112705
Gene: ENSMUSG00000051000

DomainStartEndE-ValueType
low complexity region 67 84 N/A INTRINSIC
low complexity region 197 206 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik T C 11: 59,099,802 (GRCm39) V100A probably benign Het
Adamtsl1 T C 4: 86,117,601 (GRCm39) V188A possibly damaging Het
Aldh6a1 T C 12: 84,488,646 (GRCm39) D80G probably benign Het
Ankrd50 T C 3: 38,509,412 (GRCm39) Q62R possibly damaging Het
Aopep T C 13: 63,163,021 (GRCm39) L14P probably damaging Het
Arrdc1 T A 2: 24,816,645 (GRCm39) Y177F probably damaging Het
Asap1 C T 15: 64,007,697 (GRCm39) R384Q probably damaging Het
Atxn2l A T 7: 126,096,443 (GRCm39) V433D probably benign Het
Bbs1 G A 19: 4,941,703 (GRCm39) A529V probably benign Het
Bbx G A 16: 50,100,836 (GRCm39) R20* probably null Het
Bend5 T C 4: 111,288,304 (GRCm39) V106A probably benign Het
C1galt1 A G 6: 7,863,944 (GRCm39) N8S probably benign Het
Cdc42ep1 G A 15: 78,733,880 (GRCm39) D327N possibly damaging Het
Cep162 A G 9: 87,099,198 (GRCm39) S767P probably benign Het
Cep43 T C 17: 8,401,105 (GRCm39) S209P probably damaging Het
Csmd1 T C 8: 15,945,728 (GRCm39) T3562A probably damaging Het
Dnah7a A G 1: 53,570,362 (GRCm39) S1815P probably damaging Het
Ei24 A T 9: 36,697,320 (GRCm39) L136Q probably damaging Het
Extl2 T G 3: 115,804,339 (GRCm39) M1R probably null Het
Fat3 T C 9: 16,288,104 (GRCm39) E473G probably benign Het
Fcgbpl1 G A 7: 27,853,889 (GRCm39) D1618N possibly damaging Het
G6pc3 T A 11: 102,080,827 (GRCm39) W26R probably damaging Het
Hc T A 2: 34,921,876 (GRCm39) Y610F probably benign Het
Hecw1 T C 13: 14,552,368 (GRCm39) D77G probably damaging Het
Hgf T C 5: 16,816,860 (GRCm39) V497A probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hyou1 A C 9: 44,302,148 (GRCm39) D968A probably benign Het
Jmjd1c T A 10: 67,065,692 (GRCm39) S1525T probably damaging Het
Kcnc4 G A 3: 107,354,879 (GRCm39) T523I probably benign Het
Kcng1 C T 2: 168,104,604 (GRCm39) C414Y probably damaging Het
Klhdc10 T C 6: 30,447,411 (GRCm39) I204T probably damaging Het
Krt18 A T 15: 101,938,358 (GRCm39) T194S probably benign Het
Krt76 A C 15: 101,800,842 (GRCm39) N151K probably damaging Het
Krtap31-2 A G 11: 99,827,542 (GRCm39) T125A possibly damaging Het
Lama5 A G 2: 179,831,238 (GRCm39) V1807A possibly damaging Het
Lats1 T G 10: 7,581,369 (GRCm39) V718G probably damaging Het
Mef2b A G 8: 70,616,910 (GRCm39) K4E probably damaging Het
Mertk T C 2: 128,624,537 (GRCm39) probably null Het
Mroh8 A G 2: 157,070,620 (GRCm39) V577A possibly damaging Het
Mtcl1 T G 17: 66,745,274 (GRCm39) N381T probably damaging Het
Nfyc T A 4: 120,647,688 (GRCm39) probably null Het
Nol4 C A 18: 23,172,933 (GRCm39) W56L probably damaging Het
Notch2 A T 3: 98,050,272 (GRCm39) D1849V probably damaging Het
Or10ad1 G A 15: 98,105,452 (GRCm39) T271I probably damaging Het
Or10j7 T C 1: 173,011,381 (GRCm39) T207A probably benign Het
Or14c45 A T 7: 86,176,306 (GRCm39) T114S possibly damaging Het
Or4n4b T C 14: 50,536,355 (GRCm39) N137S probably benign Het
Or5an10 A G 19: 12,276,076 (GRCm39) M140T probably damaging Het
Or7g28 T A 9: 19,272,471 (GRCm39) Y60F probably damaging Het
Or8s5 A G 15: 98,238,153 (GRCm39) V239A possibly damaging Het
Oxr1 G A 15: 41,664,978 (GRCm39) V138I probably benign Het
Pars2 A G 4: 106,511,490 (GRCm39) E424G possibly damaging Het
Peli2 C A 14: 48,405,726 (GRCm39) Y50* probably null Het
Plag1 T A 4: 3,905,492 (GRCm39) H66L probably benign Het
Psme4 T C 11: 30,771,079 (GRCm39) probably benign Het
Robo1 A T 16: 72,801,423 (GRCm39) S1016C probably damaging Het
Rrbp1 A G 2: 143,816,460 (GRCm39) V723A probably benign Het
Sgip1 C A 4: 102,778,280 (GRCm39) D292E unknown Het
Skint4 T A 4: 111,944,232 (GRCm39) C23S probably benign Het
Slc22a28 A C 19: 8,049,279 (GRCm39) S323R probably damaging Het
Slc41a3 A G 6: 90,617,891 (GRCm39) T306A probably benign Het
Spata13 A G 14: 60,987,445 (GRCm39) M868V probably damaging Het
Spata6 T G 4: 111,603,378 (GRCm39) I31S possibly damaging Het
Sycp3 A T 10: 88,302,366 (GRCm39) K119* probably null Het
Tlk2 T A 11: 105,172,046 (GRCm39) S739T unknown Het
Trim10 T C 17: 37,188,020 (GRCm39) V412A probably damaging Het
Ttc3 T A 16: 94,211,765 (GRCm39) F377I probably benign Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Unc5a T C 13: 55,143,681 (GRCm39) Y122H possibly damaging Het
Uncx C T 5: 139,530,377 (GRCm39) R152* probably null Het
Usp44 A G 10: 93,681,517 (GRCm39) probably benign Het
Vamp2 A C 11: 68,980,564 (GRCm39) D44A probably benign Het
Vmn2r83 A G 10: 79,304,849 (GRCm39) T20A probably benign Het
Vmn2r84 A T 10: 130,221,784 (GRCm39) I812N probably damaging Het
Vrtn T G 12: 84,695,943 (GRCm39) L231R probably damaging Het
Wdr75 A G 1: 45,859,333 (GRCm39) T677A probably damaging Het
Xylt1 C A 7: 117,148,100 (GRCm39) S221R possibly damaging Het
Zscan22 A G 7: 12,637,983 (GRCm39) E125G possibly damaging Het
Zxdc A T 6: 90,350,698 (GRCm39) H383L probably damaging Het
Other mutations in Fhip1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fhip1a APN 3 85,579,925 (GRCm39) missense probably benign 0.01
IGL01102:Fhip1a APN 3 85,572,808 (GRCm39) intron probably benign
IGL01317:Fhip1a APN 3 85,580,153 (GRCm39) missense probably benign 0.01
IGL01759:Fhip1a APN 3 85,595,754 (GRCm39) missense probably damaging 1.00
IGL02007:Fhip1a APN 3 85,629,752 (GRCm39) missense probably damaging 1.00
IGL02037:Fhip1a APN 3 85,637,939 (GRCm39) missense probably damaging 0.99
IGL02163:Fhip1a APN 3 85,595,859 (GRCm39) missense possibly damaging 0.92
IGL02192:Fhip1a APN 3 85,580,633 (GRCm39) missense possibly damaging 0.82
IGL02617:Fhip1a APN 3 85,580,344 (GRCm39) missense probably benign 0.00
PIT4520001:Fhip1a UTSW 3 85,579,779 (GRCm39) nonsense probably null
PIT4651001:Fhip1a UTSW 3 85,590,948 (GRCm39) missense probably damaging 1.00
R0590:Fhip1a UTSW 3 85,579,683 (GRCm39) missense probably benign 0.13
R0625:Fhip1a UTSW 3 85,637,807 (GRCm39) missense possibly damaging 0.84
R0648:Fhip1a UTSW 3 85,637,921 (GRCm39) missense probably damaging 1.00
R0931:Fhip1a UTSW 3 85,580,550 (GRCm39) missense probably benign
R0940:Fhip1a UTSW 3 85,572,797 (GRCm39) missense possibly damaging 0.92
R0941:Fhip1a UTSW 3 85,580,366 (GRCm39) missense probably benign 0.03
R1115:Fhip1a UTSW 3 85,629,802 (GRCm39) missense probably benign 0.02
R1161:Fhip1a UTSW 3 85,579,775 (GRCm39) missense probably damaging 0.96
R1460:Fhip1a UTSW 3 85,638,183 (GRCm39) missense probably damaging 1.00
R1503:Fhip1a UTSW 3 85,579,784 (GRCm39) missense possibly damaging 0.70
R1545:Fhip1a UTSW 3 85,573,261 (GRCm39) missense probably damaging 1.00
R1820:Fhip1a UTSW 3 85,573,136 (GRCm39) missense probably damaging 1.00
R1907:Fhip1a UTSW 3 85,579,940 (GRCm39) missense probably benign 0.00
R1911:Fhip1a UTSW 3 85,568,525 (GRCm39) missense probably benign 0.12
R1928:Fhip1a UTSW 3 85,595,838 (GRCm39) missense probably damaging 1.00
R2200:Fhip1a UTSW 3 85,637,628 (GRCm39) missense probably damaging 1.00
R2235:Fhip1a UTSW 3 85,568,408 (GRCm39) missense probably damaging 0.97
R2373:Fhip1a UTSW 3 85,583,404 (GRCm39) nonsense probably null
R3084:Fhip1a UTSW 3 85,573,275 (GRCm39) critical splice acceptor site probably null
R4125:Fhip1a UTSW 3 85,572,690 (GRCm39) missense possibly damaging 0.87
R4601:Fhip1a UTSW 3 85,648,487 (GRCm39) missense probably damaging 1.00
R4612:Fhip1a UTSW 3 85,637,679 (GRCm39) nonsense probably null
R4665:Fhip1a UTSW 3 85,637,988 (GRCm39) missense probably damaging 1.00
R4673:Fhip1a UTSW 3 85,638,020 (GRCm39) missense probably damaging 1.00
R4707:Fhip1a UTSW 3 85,595,877 (GRCm39) missense probably damaging 1.00
R4783:Fhip1a UTSW 3 85,595,877 (GRCm39) missense probably damaging 1.00
R4785:Fhip1a UTSW 3 85,595,877 (GRCm39) missense probably damaging 1.00
R4825:Fhip1a UTSW 3 85,580,739 (GRCm39) missense possibly damaging 0.93
R4884:Fhip1a UTSW 3 85,590,918 (GRCm39) missense probably damaging 1.00
R5653:Fhip1a UTSW 3 85,629,808 (GRCm39) missense probably damaging 1.00
R5663:Fhip1a UTSW 3 85,579,740 (GRCm39) missense probably benign
R5764:Fhip1a UTSW 3 85,573,172 (GRCm39) missense probably damaging 1.00
R6134:Fhip1a UTSW 3 85,580,651 (GRCm39) missense possibly damaging 0.93
R6284:Fhip1a UTSW 3 85,579,995 (GRCm39) missense probably benign 0.01
R6789:Fhip1a UTSW 3 85,579,865 (GRCm39) nonsense probably null
R6843:Fhip1a UTSW 3 85,580,352 (GRCm39) missense probably damaging 0.96
R7305:Fhip1a UTSW 3 85,637,831 (GRCm39) missense probably damaging 1.00
R7406:Fhip1a UTSW 3 85,637,784 (GRCm39) missense probably benign 0.13
R7448:Fhip1a UTSW 3 85,579,871 (GRCm39) missense probably benign 0.00
R7469:Fhip1a UTSW 3 85,580,069 (GRCm39) missense probably benign 0.00
R7578:Fhip1a UTSW 3 85,573,205 (GRCm39) missense probably damaging 0.99
R7707:Fhip1a UTSW 3 85,583,560 (GRCm39) missense probably benign 0.21
R8071:Fhip1a UTSW 3 85,637,868 (GRCm39) missense probably damaging 1.00
R8093:Fhip1a UTSW 3 85,580,111 (GRCm39) missense probably benign 0.01
R8151:Fhip1a UTSW 3 85,595,847 (GRCm39) missense probably damaging 1.00
R8391:Fhip1a UTSW 3 85,595,788 (GRCm39) missense probably damaging 0.98
R8406:Fhip1a UTSW 3 85,580,027 (GRCm39) missense probably benign 0.02
R8774:Fhip1a UTSW 3 85,580,097 (GRCm39) missense probably benign 0.00
R8774-TAIL:Fhip1a UTSW 3 85,580,097 (GRCm39) missense probably benign 0.00
R8843:Fhip1a UTSW 3 85,568,318 (GRCm39) missense possibly damaging 0.89
R9079:Fhip1a UTSW 3 85,579,590 (GRCm39) nonsense probably null
R9277:Fhip1a UTSW 3 85,579,565 (GRCm39) missense probably benign 0.25
R9302:Fhip1a UTSW 3 85,579,941 (GRCm39) missense probably damaging 0.99
R9324:Fhip1a UTSW 3 85,638,053 (GRCm39) missense probably benign 0.16
R9494:Fhip1a UTSW 3 85,583,565 (GRCm39) nonsense probably null
R9516:Fhip1a UTSW 3 85,580,559 (GRCm39) nonsense probably null
R9638:Fhip1a UTSW 3 85,568,391 (GRCm39) missense probably damaging 0.99
R9654:Fhip1a UTSW 3 85,579,532 (GRCm39) missense probably damaging 1.00
Z1176:Fhip1a UTSW 3 85,580,508 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCCCTCTCGATGAATGAAG -3'
(R):5'- TGCTAATCGAAGAGCAAGCC -3'

Sequencing Primer
(F):5'- CCCTCTCGATGAATGAAGGGTATC -3'
(R):5'- CCAATCCTGGAATTTGTGGTC -3'
Posted On 2019-06-07