Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4378001:Hgf'

554986

Institutional Source

Beutler Lab

Gene Symbol

Hgf

Ensembl Gene

ENSMUSG00000028864

Gene Name

hepatocyte growth factor

Synonyms

HGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4378001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16553495-16620152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16611862 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 497 (V497A)

Ref Sequence

ENSEMBL: ENSMUSP00000030683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]

AlphaFold

Q08048

PDB Structure

A Mechanistic Basis for Converting a Receptor Tyrosine Kinase Agonist to an Antagonist [X-RAY DIFFRACTION]
Crystal structure of the N-terminal fragment (31-127) of the mouse hepatocyte growth factor/scatter factor [X-RAY DIFFRACTION]
Crystal Structure of the NK2 Fragment (31-290) of the mouse Hepatocyte Growth Factor/Scatter Factor [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030683
AA Change: V497A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: V497A

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000196645
AA Change: V492A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: V492A

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	204	3.76e-42	SMART
KR	205	286	9.04e-45	SMART
KR	299	381	7.35e-45	SMART
KR	385	467	1.02e-38	SMART
Tryp_SPc	490	714	5.6e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199581
AA Change: V497A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: V497A

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Coding Region Coverage

1x: 93.1%
3x: 90.8%
10x: 85.0%
20x: 72.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,015,207	L14P	probably damaging	Het
2310033P09Rik	T	C	11: 59,208,976	V100A	probably benign	Het
9530053A07Rik	G	A	7: 28,154,464	D1618N	possibly damaging	Het
Adamtsl1	T	C	4: 86,199,364	V188A	possibly damaging	Het
Aldh6a1	T	C	12: 84,441,872	D80G	probably benign	Het
Ankrd50	T	C	3: 38,455,263	Q62R	possibly damaging	Het
Arrdc1	T	A	2: 24,926,633	Y177F	probably damaging	Het
Asap1	C	T	15: 64,135,848	R384Q	probably damaging	Het
Atxn2l	A	T	7: 126,497,271	V433D	probably benign	Het
Bbs1	G	A	19: 4,891,675	A529V	probably benign	Het
Bbx	G	A	16: 50,280,473	R20*	probably null	Het
Bend5	T	C	4: 111,431,107	V106A	probably benign	Het
C1galt1	A	G	6: 7,863,944	N8S	probably benign	Het
Cdc42ep1	G	A	15: 78,849,680	D327N	possibly damaging	Het
Cep162	A	G	9: 87,217,145	S767P	probably benign	Het
Csmd1	T	C	8: 15,895,728	T3562A	probably damaging	Het
Dnah7a	A	G	1: 53,531,203	S1815P	probably damaging	Het
Ei24	A	T	9: 36,786,024	L136Q	probably damaging	Het
Extl2	T	G	3: 116,010,690	M1R	probably null	Het
Fam160a1	A	G	3: 85,730,551	L147P	probably damaging	Het
Fat3	T	C	9: 16,376,808	E473G	probably benign	Het
Fgfr1op	T	C	17: 8,182,273	S209P	probably damaging	Het
G6pc3	T	A	11: 102,190,001	W26R	probably damaging	Het
Hc	T	A	2: 35,031,864	Y610F	probably benign	Het
Hecw1	T	C	13: 14,377,783	D77G	probably damaging	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Hyou1	A	C	9: 44,390,851	D968A	probably benign	Het
Jmjd1c	T	A	10: 67,229,913	S1525T	probably damaging	Het
Kcnc4	G	A	3: 107,447,563	T523I	probably benign	Het
Kcng1	C	T	2: 168,262,684	C414Y	probably damaging	Het
Klhdc10	T	C	6: 30,447,412	I204T	probably damaging	Het
Krt18	A	T	15: 102,029,923	T194S	probably benign	Het
Krt76	A	C	15: 101,892,407	N151K	probably damaging	Het
Krtap31-2	A	G	11: 99,936,716	T125A	possibly damaging	Het
Lama5	A	G	2: 180,189,445	V1807A	possibly damaging	Het
Lats1	T	G	10: 7,705,605	V718G	probably damaging	Het
Mef2b	A	G	8: 70,164,260	K4E	probably damaging	Het
Mertk	T	C	2: 128,782,617		probably null	Het
Mroh8	A	G	2: 157,228,700	V577A	possibly damaging	Het
Mtcl1	T	G	17: 66,438,279	N381T	probably damaging	Het
Nfyc	T	A	4: 120,790,491		probably null	Het
Nol4	C	A	18: 23,039,876	W56L	probably damaging	Het
Notch2	A	T	3: 98,142,956	D1849V	probably damaging	Het
Olfr1406	T	C	1: 173,183,814	T207A	probably benign	Het
Olfr1436	A	G	19: 12,298,712	M140T	probably damaging	Het
Olfr284	A	G	15: 98,340,272	V239A	possibly damaging	Het
Olfr287	G	A	15: 98,207,571	T271I	probably damaging	Het
Olfr297	A	T	7: 86,527,098	T114S	possibly damaging	Het
Olfr733	T	C	14: 50,298,898	N137S	probably benign	Het
Olfr846	T	A	9: 19,361,175	Y60F	probably damaging	Het
Oxr1	G	A	15: 41,801,582	V138I	probably benign	Het
Pars2	A	G	4: 106,654,293	E424G	possibly damaging	Het
Peli2	C	A	14: 48,168,269	Y50*	probably null	Het
Plag1	T	A	4: 3,905,492	H66L	probably benign	Het
Psme4	T	C	11: 30,821,079		probably benign	Het
Robo1	A	T	16: 73,004,535	S1016C	probably damaging	Het
Rrbp1	A	G	2: 143,974,540	V723A	probably benign	Het
Sgip1	C	A	4: 102,921,083	D292E	unknown	Het
Skint4	T	A	4: 112,087,035	C23S	probably benign	Het
Slc22a28	A	C	19: 8,071,914	S323R	probably damaging	Het
Slc41a3	A	G	6: 90,640,909	T306A	probably benign	Het
Spata13	A	G	14: 60,749,996	M868V	probably damaging	Het
Spata6	T	G	4: 111,746,181	I31S	possibly damaging	Het
Sycp3	A	T	10: 88,466,504	K119*	probably null	Het
Tlk2	T	A	11: 105,281,220	S739T	unknown	Het
Trim10	T	C	17: 36,877,128	V412A	probably damaging	Het
Ttc3	T	A	16: 94,410,906	F377I	probably benign	Het
Uck1	T	A	2: 32,256,034	H283L	probably damaging	Het
Unc5a	T	C	13: 54,995,868	Y122H	possibly damaging	Het
Uncx	C	T	5: 139,544,622	R152*	probably null	Het
Usp44	A	G	10: 93,845,655		probably benign	Het
Vamp2	A	C	11: 69,089,738	D44A	probably benign	Het
Vmn2r83	A	G	10: 79,469,015	T20A	probably benign	Het
Vmn2r84	A	T	10: 130,385,915	I812N	probably damaging	Het
Vrtn	T	G	12: 84,649,169	L231R	probably damaging	Het
Wdr75	A	G	1: 45,820,173	T677A	probably damaging	Het
Xylt1	C	A	7: 117,548,865	S221R	possibly damaging	Het
Zscan22	A	G	7: 12,904,056	E125G	possibly damaging	Het
Zxdc	A	T	6: 90,373,716	H383L	probably damaging	Het

Other mutations in Hgf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Hgf	APN	5	16611882	missense	possibly damaging	0.70
IGL00427:Hgf	APN	5	16578486	missense	probably benign	0.09
IGL00788:Hgf	APN	5	16598230	missense	probably damaging	0.99
IGL01290:Hgf	APN	5	16604846	missense	probably damaging	1.00
IGL01333:Hgf	APN	5	16576941	nonsense	probably null
IGL01568:Hgf	APN	5	16564814	missense	probably damaging	1.00
IGL02314:Hgf	APN	5	16572602	missense	probably damaging	0.99
IGL02328:Hgf	APN	5	16598221	missense	probably damaging	1.00
IGL02368:Hgf	APN	5	16564794	missense	possibly damaging	0.95
IGL02486:Hgf	APN	5	16602289	missense	probably damaging	1.00
IGL02654:Hgf	APN	5	16561051	missense	probably benign
Foiegras	UTSW	5	16615802	missense	probably benign	0.01
R0708:Hgf	UTSW	5	16566763	nonsense	probably null
R0710:Hgf	UTSW	5	16566763	nonsense	probably null
R0718:Hgf	UTSW	5	16593859	missense	probably damaging	1.00
R0967:Hgf	UTSW	5	16593841	splice site	probably benign
R1181:Hgf	UTSW	5	16618925	missense	probably damaging	1.00
R1589:Hgf	UTSW	5	16613785	missense	probably damaging	1.00
R1705:Hgf	UTSW	5	16615802	missense	probably benign	0.01
R1983:Hgf	UTSW	5	16561012	missense	possibly damaging	0.53
R2021:Hgf	UTSW	5	16576921	missense	probably benign
R2441:Hgf	UTSW	5	16604790	missense	probably damaging	0.99
R4083:Hgf	UTSW	5	16615858	nonsense	probably null
R4084:Hgf	UTSW	5	16615858	nonsense	probably null
R4211:Hgf	UTSW	5	16614993	missense	probably damaging	0.99
R4388:Hgf	UTSW	5	16614943	missense	probably benign	0.12
R4394:Hgf	UTSW	5	16618951	nonsense	probably null
R4575:Hgf	UTSW	5	16572601	missense	probably benign
R5044:Hgf	UTSW	5	16614894	missense	probably benign	0.00
R5319:Hgf	UTSW	5	16566862	critical splice donor site	probably null
R5585:Hgf	UTSW	5	16564801	missense	possibly damaging	0.93
R5700:Hgf	UTSW	5	16610124	missense	probably damaging	1.00
R5814:Hgf	UTSW	5	16602307	missense	probably benign	0.19
R6125:Hgf	UTSW	5	16598161	missense	probably damaging	1.00
R6749:Hgf	UTSW	5	16613642	splice site	probably null
R6891:Hgf	UTSW	5	16604922	critical splice donor site	probably null
R6962:Hgf	UTSW	5	16615754	missense	probably benign	0.32
R7251:Hgf	UTSW	5	16593944	missense	possibly damaging	0.95
R7296:Hgf	UTSW	5	16564843	missense	probably benign	0.39
R7463:Hgf	UTSW	5	16578450	missense	probably benign	0.00
R7470:Hgf	UTSW	5	16618856	missense	probably benign	0.02
R7630:Hgf	UTSW	5	16598250	missense	probably benign	0.01
R7807:Hgf	UTSW	5	16577011	missense	probably damaging	0.99
R8098:Hgf	UTSW	5	16561061	missense	probably benign	0.04
R8120:Hgf	UTSW	5	16613781	missense	probably damaging	1.00
R8132:Hgf	UTSW	5	16602331	missense	probably damaging	1.00
R8499:Hgf	UTSW	5	16566856	missense	probably damaging	0.99
R8929:Hgf	UTSW	5	16593990	missense	probably benign	0.44
R9016:Hgf	UTSW	5	16618958	missense	probably damaging	1.00
R9126:Hgf	UTSW	5	16560981	missense	possibly damaging	0.95
R9197:Hgf	UTSW	5	16561061	missense	probably benign	0.04
R9347:Hgf	UTSW	5	16604923	critical splice donor site	probably null
R9478:Hgf	UTSW	5	16561031	missense	possibly damaging	0.70
X0024:Hgf	UTSW	5	16604828	missense	probably damaging	1.00
Z1088:Hgf	UTSW	5	16618919	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCACTCAACAGCAAGGATGAAC -3'
(R):5'- GGACAGAAATCAGTCCCTGGTC -3'

Sequencing Primer
(F):5'- GATGAACATAGCAAGTATCTTAGGC -3'
(R):5'- CCCCAGCTTAGTGTCTTGTATGG -3'

Posted On

2019-06-07