Incidental Mutation 'PIT4378001:Hgf'
ID554986
Institutional Source Beutler Lab
Gene Symbol Hgf
Ensembl Gene ENSMUSG00000028864
Gene Namehepatocyte growth factor
SynonymsHGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4378001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location16553495-16620152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16611862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 497 (V497A)
Ref Sequence ENSEMBL: ENSMUSP00000030683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]
PDB Structure A Mechanistic Basis for Converting a Receptor Tyrosine Kinase Agonist to an Antagonist [X-RAY DIFFRACTION]
Crystal structure of the N-terminal fragment (31-127) of the mouse hepatocyte growth factor/scatter factor [X-RAY DIFFRACTION]
Crystal Structure of the NK2 Fragment (31-290) of the mouse Hepatocyte Growth Factor/Scatter Factor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030683
AA Change: V497A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196645
AA Change: V492A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: V492A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 204 3.76e-42 SMART
KR 205 286 9.04e-45 SMART
KR 299 381 7.35e-45 SMART
KR 385 467 1.02e-38 SMART
Tryp_SPc 490 714 5.6e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199581
AA Change: V497A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: V497A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,015,207 L14P probably damaging Het
2310033P09Rik T C 11: 59,208,976 V100A probably benign Het
9530053A07Rik G A 7: 28,154,464 D1618N possibly damaging Het
Adamtsl1 T C 4: 86,199,364 V188A possibly damaging Het
Aldh6a1 T C 12: 84,441,872 D80G probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Arrdc1 T A 2: 24,926,633 Y177F probably damaging Het
Asap1 C T 15: 64,135,848 R384Q probably damaging Het
Atxn2l A T 7: 126,497,271 V433D probably benign Het
Bbs1 G A 19: 4,891,675 A529V probably benign Het
Bbx G A 16: 50,280,473 R20* probably null Het
Bend5 T C 4: 111,431,107 V106A probably benign Het
C1galt1 A G 6: 7,863,944 N8S probably benign Het
Cdc42ep1 G A 15: 78,849,680 D327N possibly damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Csmd1 T C 8: 15,895,728 T3562A probably damaging Het
Dnah7a A G 1: 53,531,203 S1815P probably damaging Het
Ei24 A T 9: 36,786,024 L136Q probably damaging Het
Extl2 T G 3: 116,010,690 M1R probably null Het
Fam160a1 A G 3: 85,730,551 L147P probably damaging Het
Fat3 T C 9: 16,376,808 E473G probably benign Het
Fgfr1op T C 17: 8,182,273 S209P probably damaging Het
G6pc3 T A 11: 102,190,001 W26R probably damaging Het
Hc T A 2: 35,031,864 Y610F probably benign Het
Hecw1 T C 13: 14,377,783 D77G probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hyou1 A C 9: 44,390,851 D968A probably benign Het
Jmjd1c T A 10: 67,229,913 S1525T probably damaging Het
Kcnc4 G A 3: 107,447,563 T523I probably benign Het
Kcng1 C T 2: 168,262,684 C414Y probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Krt18 A T 15: 102,029,923 T194S probably benign Het
Krt76 A C 15: 101,892,407 N151K probably damaging Het
Krtap31-2 A G 11: 99,936,716 T125A possibly damaging Het
Lama5 A G 2: 180,189,445 V1807A possibly damaging Het
Lats1 T G 10: 7,705,605 V718G probably damaging Het
Mef2b A G 8: 70,164,260 K4E probably damaging Het
Mertk T C 2: 128,782,617 probably null Het
Mroh8 A G 2: 157,228,700 V577A possibly damaging Het
Mtcl1 T G 17: 66,438,279 N381T probably damaging Het
Nfyc T A 4: 120,790,491 probably null Het
Nol4 C A 18: 23,039,876 W56L probably damaging Het
Notch2 A T 3: 98,142,956 D1849V probably damaging Het
Olfr1406 T C 1: 173,183,814 T207A probably benign Het
Olfr1436 A G 19: 12,298,712 M140T probably damaging Het
Olfr284 A G 15: 98,340,272 V239A possibly damaging Het
Olfr287 G A 15: 98,207,571 T271I probably damaging Het
Olfr297 A T 7: 86,527,098 T114S possibly damaging Het
Olfr733 T C 14: 50,298,898 N137S probably benign Het
Olfr846 T A 9: 19,361,175 Y60F probably damaging Het
Oxr1 G A 15: 41,801,582 V138I probably benign Het
Pars2 A G 4: 106,654,293 E424G possibly damaging Het
Peli2 C A 14: 48,168,269 Y50* probably null Het
Plag1 T A 4: 3,905,492 H66L probably benign Het
Psme4 T C 11: 30,821,079 probably benign Het
Robo1 A T 16: 73,004,535 S1016C probably damaging Het
Rrbp1 A G 2: 143,974,540 V723A probably benign Het
Sgip1 C A 4: 102,921,083 D292E unknown Het
Skint4 T A 4: 112,087,035 C23S probably benign Het
Slc22a28 A C 19: 8,071,914 S323R probably damaging Het
Slc41a3 A G 6: 90,640,909 T306A probably benign Het
Spata13 A G 14: 60,749,996 M868V probably damaging Het
Spata6 T G 4: 111,746,181 I31S possibly damaging Het
Sycp3 A T 10: 88,466,504 K119* probably null Het
Tlk2 T A 11: 105,281,220 S739T unknown Het
Trim10 T C 17: 36,877,128 V412A probably damaging Het
Ttc3 T A 16: 94,410,906 F377I probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Unc5a T C 13: 54,995,868 Y122H possibly damaging Het
Uncx C T 5: 139,544,622 R152* probably null Het
Usp44 A G 10: 93,845,655 probably benign Het
Vamp2 A C 11: 69,089,738 D44A probably benign Het
Vmn2r83 A G 10: 79,469,015 T20A probably benign Het
Vmn2r84 A T 10: 130,385,915 I812N probably damaging Het
Vrtn T G 12: 84,649,169 L231R probably damaging Het
Wdr75 A G 1: 45,820,173 T677A probably damaging Het
Xylt1 C A 7: 117,548,865 S221R possibly damaging Het
Zscan22 A G 7: 12,904,056 E125G possibly damaging Het
Zxdc A T 6: 90,373,716 H383L probably damaging Het
Other mutations in Hgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Hgf APN 5 16611882 missense possibly damaging 0.70
IGL00427:Hgf APN 5 16578486 missense probably benign 0.09
IGL00788:Hgf APN 5 16598230 missense probably damaging 0.99
IGL01290:Hgf APN 5 16604846 missense probably damaging 1.00
IGL01333:Hgf APN 5 16576941 nonsense probably null
IGL01568:Hgf APN 5 16564814 missense probably damaging 1.00
IGL02314:Hgf APN 5 16572602 missense probably damaging 0.99
IGL02328:Hgf APN 5 16598221 missense probably damaging 1.00
IGL02368:Hgf APN 5 16564794 missense possibly damaging 0.95
IGL02486:Hgf APN 5 16602289 missense probably damaging 1.00
IGL02654:Hgf APN 5 16561051 missense probably benign
Foiegras UTSW 5 16615802 missense probably benign 0.01
R0708:Hgf UTSW 5 16566763 nonsense probably null
R0710:Hgf UTSW 5 16566763 nonsense probably null
R0718:Hgf UTSW 5 16593859 missense probably damaging 1.00
R0967:Hgf UTSW 5 16593841 splice site probably benign
R1181:Hgf UTSW 5 16618925 missense probably damaging 1.00
R1589:Hgf UTSW 5 16613785 missense probably damaging 1.00
R1705:Hgf UTSW 5 16615802 missense probably benign 0.01
R1983:Hgf UTSW 5 16561012 missense possibly damaging 0.53
R2021:Hgf UTSW 5 16576921 missense probably benign
R2441:Hgf UTSW 5 16604790 missense probably damaging 0.99
R4083:Hgf UTSW 5 16615858 nonsense probably null
R4084:Hgf UTSW 5 16615858 nonsense probably null
R4211:Hgf UTSW 5 16614993 missense probably damaging 0.99
R4388:Hgf UTSW 5 16614943 missense probably benign 0.12
R4394:Hgf UTSW 5 16618951 nonsense probably null
R4575:Hgf UTSW 5 16572601 missense probably benign
R5044:Hgf UTSW 5 16614894 missense probably benign 0.00
R5319:Hgf UTSW 5 16566862 critical splice donor site probably null
R5585:Hgf UTSW 5 16564801 missense possibly damaging 0.93
R5700:Hgf UTSW 5 16610124 missense probably damaging 1.00
R5814:Hgf UTSW 5 16602307 missense probably benign 0.19
R6125:Hgf UTSW 5 16598161 missense probably damaging 1.00
R6749:Hgf UTSW 5 16613642 splice site probably null
R6891:Hgf UTSW 5 16604922 critical splice donor site probably null
R6962:Hgf UTSW 5 16615754 missense probably benign 0.32
R7251:Hgf UTSW 5 16593944 missense possibly damaging 0.95
R7296:Hgf UTSW 5 16564843 missense probably benign 0.39
R7463:Hgf UTSW 5 16578450 missense probably benign 0.00
R7470:Hgf UTSW 5 16618856 missense probably benign 0.02
R7630:Hgf UTSW 5 16598250 missense probably benign 0.01
R7807:Hgf UTSW 5 16577011 missense probably damaging 0.99
R8098:Hgf UTSW 5 16561061 missense probably benign 0.04
R8120:Hgf UTSW 5 16613781 missense probably damaging 1.00
R8132:Hgf UTSW 5 16602331 missense probably damaging 1.00
R8499:Hgf UTSW 5 16566856 missense probably damaging 0.99
X0024:Hgf UTSW 5 16604828 missense probably damaging 1.00
Z1088:Hgf UTSW 5 16618919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACTCAACAGCAAGGATGAAC -3'
(R):5'- GGACAGAAATCAGTCCCTGGTC -3'

Sequencing Primer
(F):5'- GATGAACATAGCAAGTATCTTAGGC -3'
(R):5'- CCCCAGCTTAGTGTCTTGTATGG -3'
Posted On2019-06-07