Incidental Mutation 'PIT4378001:Fcgbpl1'
ID 554993
Institutional Source Beutler Lab
Gene Symbol Fcgbpl1
Ensembl Gene ENSMUSG00000078776
Gene Name Fc fragment of IgG binding protein like 1
Synonyms 9530053A07Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # PIT4378001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 27828891-27864236 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 27853889 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1618 (D1618N)
Ref Sequence ENSEMBL: ENSMUSP00000056479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect possibly damaging
Transcript: ENSMUST00000059886
AA Change: D1618N

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: D1618N

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150948
AA Change: D1618N

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: D1618N

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik T C 11: 59,099,802 (GRCm39) V100A probably benign Het
Adamtsl1 T C 4: 86,117,601 (GRCm39) V188A possibly damaging Het
Aldh6a1 T C 12: 84,488,646 (GRCm39) D80G probably benign Het
Ankrd50 T C 3: 38,509,412 (GRCm39) Q62R possibly damaging Het
Aopep T C 13: 63,163,021 (GRCm39) L14P probably damaging Het
Arrdc1 T A 2: 24,816,645 (GRCm39) Y177F probably damaging Het
Asap1 C T 15: 64,007,697 (GRCm39) R384Q probably damaging Het
Atxn2l A T 7: 126,096,443 (GRCm39) V433D probably benign Het
Bbs1 G A 19: 4,941,703 (GRCm39) A529V probably benign Het
Bbx G A 16: 50,100,836 (GRCm39) R20* probably null Het
Bend5 T C 4: 111,288,304 (GRCm39) V106A probably benign Het
C1galt1 A G 6: 7,863,944 (GRCm39) N8S probably benign Het
Cdc42ep1 G A 15: 78,733,880 (GRCm39) D327N possibly damaging Het
Cep162 A G 9: 87,099,198 (GRCm39) S767P probably benign Het
Cep43 T C 17: 8,401,105 (GRCm39) S209P probably damaging Het
Csmd1 T C 8: 15,945,728 (GRCm39) T3562A probably damaging Het
Dnah7a A G 1: 53,570,362 (GRCm39) S1815P probably damaging Het
Ei24 A T 9: 36,697,320 (GRCm39) L136Q probably damaging Het
Extl2 T G 3: 115,804,339 (GRCm39) M1R probably null Het
Fat3 T C 9: 16,288,104 (GRCm39) E473G probably benign Het
Fhip1a A G 3: 85,637,858 (GRCm39) L147P probably damaging Het
G6pc3 T A 11: 102,080,827 (GRCm39) W26R probably damaging Het
Hc T A 2: 34,921,876 (GRCm39) Y610F probably benign Het
Hecw1 T C 13: 14,552,368 (GRCm39) D77G probably damaging Het
Hgf T C 5: 16,816,860 (GRCm39) V497A probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hyou1 A C 9: 44,302,148 (GRCm39) D968A probably benign Het
Jmjd1c T A 10: 67,065,692 (GRCm39) S1525T probably damaging Het
Kcnc4 G A 3: 107,354,879 (GRCm39) T523I probably benign Het
Kcng1 C T 2: 168,104,604 (GRCm39) C414Y probably damaging Het
Klhdc10 T C 6: 30,447,411 (GRCm39) I204T probably damaging Het
Krt18 A T 15: 101,938,358 (GRCm39) T194S probably benign Het
Krt76 A C 15: 101,800,842 (GRCm39) N151K probably damaging Het
Krtap31-2 A G 11: 99,827,542 (GRCm39) T125A possibly damaging Het
Lama5 A G 2: 179,831,238 (GRCm39) V1807A possibly damaging Het
Lats1 T G 10: 7,581,369 (GRCm39) V718G probably damaging Het
Mef2b A G 8: 70,616,910 (GRCm39) K4E probably damaging Het
Mertk T C 2: 128,624,537 (GRCm39) probably null Het
Mroh8 A G 2: 157,070,620 (GRCm39) V577A possibly damaging Het
Mtcl1 T G 17: 66,745,274 (GRCm39) N381T probably damaging Het
Nfyc T A 4: 120,647,688 (GRCm39) probably null Het
Nol4 C A 18: 23,172,933 (GRCm39) W56L probably damaging Het
Notch2 A T 3: 98,050,272 (GRCm39) D1849V probably damaging Het
Or10ad1 G A 15: 98,105,452 (GRCm39) T271I probably damaging Het
Or10j7 T C 1: 173,011,381 (GRCm39) T207A probably benign Het
Or14c45 A T 7: 86,176,306 (GRCm39) T114S possibly damaging Het
Or4n4b T C 14: 50,536,355 (GRCm39) N137S probably benign Het
Or5an10 A G 19: 12,276,076 (GRCm39) M140T probably damaging Het
Or7g28 T A 9: 19,272,471 (GRCm39) Y60F probably damaging Het
Or8s5 A G 15: 98,238,153 (GRCm39) V239A possibly damaging Het
Oxr1 G A 15: 41,664,978 (GRCm39) V138I probably benign Het
Pars2 A G 4: 106,511,490 (GRCm39) E424G possibly damaging Het
Peli2 C A 14: 48,405,726 (GRCm39) Y50* probably null Het
Plag1 T A 4: 3,905,492 (GRCm39) H66L probably benign Het
Psme4 T C 11: 30,771,079 (GRCm39) probably benign Het
Robo1 A T 16: 72,801,423 (GRCm39) S1016C probably damaging Het
Rrbp1 A G 2: 143,816,460 (GRCm39) V723A probably benign Het
Sgip1 C A 4: 102,778,280 (GRCm39) D292E unknown Het
Skint4 T A 4: 111,944,232 (GRCm39) C23S probably benign Het
Slc22a28 A C 19: 8,049,279 (GRCm39) S323R probably damaging Het
Slc41a3 A G 6: 90,617,891 (GRCm39) T306A probably benign Het
Spata13 A G 14: 60,987,445 (GRCm39) M868V probably damaging Het
Spata6 T G 4: 111,603,378 (GRCm39) I31S possibly damaging Het
Sycp3 A T 10: 88,302,366 (GRCm39) K119* probably null Het
Tlk2 T A 11: 105,172,046 (GRCm39) S739T unknown Het
Trim10 T C 17: 37,188,020 (GRCm39) V412A probably damaging Het
Ttc3 T A 16: 94,211,765 (GRCm39) F377I probably benign Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Unc5a T C 13: 55,143,681 (GRCm39) Y122H possibly damaging Het
Uncx C T 5: 139,530,377 (GRCm39) R152* probably null Het
Usp44 A G 10: 93,681,517 (GRCm39) probably benign Het
Vamp2 A C 11: 68,980,564 (GRCm39) D44A probably benign Het
Vmn2r83 A G 10: 79,304,849 (GRCm39) T20A probably benign Het
Vmn2r84 A T 10: 130,221,784 (GRCm39) I812N probably damaging Het
Vrtn T G 12: 84,695,943 (GRCm39) L231R probably damaging Het
Wdr75 A G 1: 45,859,333 (GRCm39) T677A probably damaging Het
Xylt1 C A 7: 117,148,100 (GRCm39) S221R possibly damaging Het
Zscan22 A G 7: 12,637,983 (GRCm39) E125G possibly damaging Het
Zxdc A T 6: 90,350,698 (GRCm39) H383L probably damaging Het
Other mutations in Fcgbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fcgbpl1 APN 7 27,863,953 (GRCm39) missense probably damaging 1.00
IGL00757:Fcgbpl1 APN 7 27,853,870 (GRCm39) missense probably damaging 1.00
IGL01015:Fcgbpl1 APN 7 27,854,743 (GRCm39) missense probably damaging 1.00
IGL01079:Fcgbpl1 APN 7 27,839,203 (GRCm39) missense probably damaging 0.99
IGL01343:Fcgbpl1 APN 7 27,850,127 (GRCm39) missense probably benign 0.19
IGL01420:Fcgbpl1 APN 7 27,839,558 (GRCm39) missense probably benign 0.28
IGL01604:Fcgbpl1 APN 7 27,854,749 (GRCm39) missense probably benign 0.11
IGL01666:Fcgbpl1 APN 7 27,852,717 (GRCm39) missense probably damaging 1.00
IGL02002:Fcgbpl1 APN 7 27,852,221 (GRCm39) missense probably damaging 1.00
IGL02036:Fcgbpl1 APN 7 27,836,950 (GRCm39) missense possibly damaging 0.82
IGL02126:Fcgbpl1 APN 7 27,839,281 (GRCm39) missense probably damaging 1.00
IGL02150:Fcgbpl1 APN 7 27,846,204 (GRCm39) nonsense probably null
IGL02219:Fcgbpl1 APN 7 27,854,060 (GRCm39) missense probably damaging 1.00
IGL02563:Fcgbpl1 APN 7 27,857,317 (GRCm39) missense probably benign
IGL02804:Fcgbpl1 APN 7 27,852,795 (GRCm39) missense probably benign 0.00
IGL02830:Fcgbpl1 APN 7 27,862,348 (GRCm39) missense probably damaging 1.00
IGL02943:Fcgbpl1 APN 7 27,846,613 (GRCm39) missense probably damaging 1.00
IGL02977:Fcgbpl1 APN 7 27,863,797 (GRCm39) missense possibly damaging 0.83
IGL03231:Fcgbpl1 APN 7 27,853,147 (GRCm39) missense possibly damaging 0.95
IGL03304:Fcgbpl1 APN 7 27,841,667 (GRCm39) missense probably damaging 0.99
herz UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
pulse UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
Sinusoidal UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R0023:Fcgbpl1 UTSW 7 27,852,837 (GRCm39) missense probably benign 0.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0132:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0158:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R0230:Fcgbpl1 UTSW 7 27,856,250 (GRCm39) missense probably damaging 1.00
R0310:Fcgbpl1 UTSW 7 27,841,699 (GRCm39) missense probably benign 0.04
R0448:Fcgbpl1 UTSW 7 27,839,660 (GRCm39) missense probably benign 0.03
R0462:Fcgbpl1 UTSW 7 27,836,765 (GRCm39) missense probably damaging 1.00
R0481:Fcgbpl1 UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
R0497:Fcgbpl1 UTSW 7 27,846,890 (GRCm39) missense probably damaging 1.00
R0556:Fcgbpl1 UTSW 7 27,858,803 (GRCm39) missense probably benign
R0562:Fcgbpl1 UTSW 7 27,862,115 (GRCm39) missense probably benign 0.30
R0586:Fcgbpl1 UTSW 7 27,836,516 (GRCm39) missense probably damaging 0.99
R0924:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R0930:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R1103:Fcgbpl1 UTSW 7 27,853,945 (GRCm39) missense probably damaging 1.00
R1213:Fcgbpl1 UTSW 7 27,857,098 (GRCm39) missense probably damaging 1.00
R1292:Fcgbpl1 UTSW 7 27,842,219 (GRCm39) splice site probably benign
R1368:Fcgbpl1 UTSW 7 27,858,903 (GRCm39) missense possibly damaging 0.89
R1451:Fcgbpl1 UTSW 7 27,836,582 (GRCm39) missense probably damaging 1.00
R1477:Fcgbpl1 UTSW 7 27,856,518 (GRCm39) missense probably benign 0.01
R1538:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R1655:Fcgbpl1 UTSW 7 27,846,535 (GRCm39) missense probably damaging 0.98
R1697:Fcgbpl1 UTSW 7 27,853,772 (GRCm39) missense probably damaging 1.00
R1741:Fcgbpl1 UTSW 7 27,857,279 (GRCm39) missense probably damaging 0.98
R1796:Fcgbpl1 UTSW 7 27,854,797 (GRCm39) missense probably damaging 1.00
R1853:Fcgbpl1 UTSW 7 27,854,971 (GRCm39) nonsense probably null
R1861:Fcgbpl1 UTSW 7 27,854,157 (GRCm39) missense probably damaging 1.00
R1909:Fcgbpl1 UTSW 7 27,843,773 (GRCm39) missense possibly damaging 0.52
R1971:Fcgbpl1 UTSW 7 27,830,937 (GRCm39) missense possibly damaging 0.90
R1990:Fcgbpl1 UTSW 7 27,853,785 (GRCm39) missense probably damaging 0.98
R2020:Fcgbpl1 UTSW 7 27,855,019 (GRCm39) missense probably benign
R2084:Fcgbpl1 UTSW 7 27,856,960 (GRCm39) missense probably damaging 1.00
R2125:Fcgbpl1 UTSW 7 27,857,447 (GRCm39) missense probably benign 0.00
R2132:Fcgbpl1 UTSW 7 27,854,899 (GRCm39) missense probably damaging 1.00
R2513:Fcgbpl1 UTSW 7 27,831,060 (GRCm39) missense probably damaging 0.99
R2913:Fcgbpl1 UTSW 7 27,863,732 (GRCm39) missense probably damaging 1.00
R3150:Fcgbpl1 UTSW 7 27,853,620 (GRCm39) missense probably benign 0.21
R3499:Fcgbpl1 UTSW 7 27,853,980 (GRCm39) missense probably benign 0.42
R3702:Fcgbpl1 UTSW 7 27,857,203 (GRCm39) missense probably damaging 1.00
R3881:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R3938:Fcgbpl1 UTSW 7 27,853,719 (GRCm39) missense probably damaging 1.00
R4050:Fcgbpl1 UTSW 7 27,852,410 (GRCm39) missense possibly damaging 0.55
R4152:Fcgbpl1 UTSW 7 27,856,322 (GRCm39) missense possibly damaging 0.47
R4168:Fcgbpl1 UTSW 7 27,836,534 (GRCm39) missense probably benign 0.05
R4235:Fcgbpl1 UTSW 7 27,856,073 (GRCm39) missense probably damaging 0.99
R4241:Fcgbpl1 UTSW 7 27,853,760 (GRCm39) missense probably damaging 1.00
R4363:Fcgbpl1 UTSW 7 27,846,331 (GRCm39) missense probably damaging 1.00
R4460:Fcgbpl1 UTSW 7 27,852,281 (GRCm39) missense probably benign 0.17
R4463:Fcgbpl1 UTSW 7 27,850,144 (GRCm39) missense probably benign
R4841:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4842:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4876:Fcgbpl1 UTSW 7 27,842,225 (GRCm39) intron probably benign
R4905:Fcgbpl1 UTSW 7 27,856,408 (GRCm39) missense possibly damaging 0.93
R4997:Fcgbpl1 UTSW 7 27,843,349 (GRCm39) missense possibly damaging 0.77
R5091:Fcgbpl1 UTSW 7 27,856,383 (GRCm39) missense probably benign 0.44
R5159:Fcgbpl1 UTSW 7 27,852,733 (GRCm39) missense probably benign 0.09
R5326:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5396:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign
R5441:Fcgbpl1 UTSW 7 27,856,339 (GRCm39) missense probably damaging 1.00
R5480:Fcgbpl1 UTSW 7 27,857,424 (GRCm39) nonsense probably null
R5542:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5571:Fcgbpl1 UTSW 7 27,855,994 (GRCm39) missense probably damaging 0.99
R5613:Fcgbpl1 UTSW 7 27,842,303 (GRCm39) intron probably benign
R5637:Fcgbpl1 UTSW 7 27,852,277 (GRCm39) missense probably benign 0.00
R5766:Fcgbpl1 UTSW 7 27,836,754 (GRCm39) nonsense probably null
R6174:Fcgbpl1 UTSW 7 27,839,384 (GRCm39) missense probably damaging 0.96
R6233:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R6250:Fcgbpl1 UTSW 7 27,850,139 (GRCm39) missense probably damaging 1.00
R6379:Fcgbpl1 UTSW 7 27,857,017 (GRCm39) missense probably damaging 1.00
R6442:Fcgbpl1 UTSW 7 27,843,611 (GRCm39) missense possibly damaging 0.88
R6478:Fcgbpl1 UTSW 7 27,854,798 (GRCm39) missense probably damaging 1.00
R6699:Fcgbpl1 UTSW 7 27,843,793 (GRCm39) missense probably damaging 1.00
R6852:Fcgbpl1 UTSW 7 27,846,560 (GRCm39) missense probably damaging 1.00
R6883:Fcgbpl1 UTSW 7 27,852,260 (GRCm39) missense possibly damaging 0.89
R6902:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6903:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6904:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6992:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign 0.04
R7023:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R7039:Fcgbpl1 UTSW 7 27,839,573 (GRCm39) missense possibly damaging 0.80
R7171:Fcgbpl1 UTSW 7 27,853,944 (GRCm39) nonsense probably null
R7282:Fcgbpl1 UTSW 7 27,843,833 (GRCm39) missense probably benign 0.02
R7291:Fcgbpl1 UTSW 7 27,839,645 (GRCm39) missense probably benign
R7344:Fcgbpl1 UTSW 7 27,852,185 (GRCm39) missense possibly damaging 0.46
R7344:Fcgbpl1 UTSW 7 27,839,704 (GRCm39) missense possibly damaging 0.79
R7392:Fcgbpl1 UTSW 7 27,863,797 (GRCm39) missense possibly damaging 0.83
R7531:Fcgbpl1 UTSW 7 27,839,656 (GRCm39) missense probably benign
R7541:Fcgbpl1 UTSW 7 27,843,681 (GRCm39) nonsense probably null
R7577:Fcgbpl1 UTSW 7 27,853,848 (GRCm39) missense possibly damaging 0.65
R7594:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R7647:Fcgbpl1 UTSW 7 27,839,470 (GRCm39) missense probably benign 0.00
R7718:Fcgbpl1 UTSW 7 27,846,626 (GRCm39) missense probably damaging 1.00
R7733:Fcgbpl1 UTSW 7 27,839,390 (GRCm39) missense probably damaging 1.00
R7737:Fcgbpl1 UTSW 7 27,856,498 (GRCm39) missense probably damaging 1.00
R7908:Fcgbpl1 UTSW 7 27,846,921 (GRCm39) missense probably benign 0.12
R8013:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8014:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8151:Fcgbpl1 UTSW 7 27,852,766 (GRCm39) missense possibly damaging 0.95
R8175:Fcgbpl1 UTSW 7 27,863,873 (GRCm39) nonsense probably null
R8254:Fcgbpl1 UTSW 7 27,846,774 (GRCm39) missense possibly damaging 0.63
R8345:Fcgbpl1 UTSW 7 27,854,785 (GRCm39) missense probably damaging 1.00
R8414:Fcgbpl1 UTSW 7 27,842,158 (GRCm39) missense probably damaging 1.00
R8419:Fcgbpl1 UTSW 7 27,843,346 (GRCm39) missense probably damaging 1.00
R8496:Fcgbpl1 UTSW 7 27,843,377 (GRCm39) missense possibly damaging 0.81
R8691:Fcgbpl1 UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
R8785:Fcgbpl1 UTSW 7 27,854,132 (GRCm39) missense probably damaging 1.00
R8863:Fcgbpl1 UTSW 7 27,831,006 (GRCm39) missense probably damaging 1.00
R8926:Fcgbpl1 UTSW 7 27,853,869 (GRCm39) missense probably damaging 1.00
R8950:Fcgbpl1 UTSW 7 27,863,751 (GRCm39) missense probably benign 0.32
R9014:Fcgbpl1 UTSW 7 27,854,876 (GRCm39) missense probably damaging 1.00
R9045:Fcgbpl1 UTSW 7 27,853,856 (GRCm39) missense probably damaging 1.00
R9115:Fcgbpl1 UTSW 7 27,853,754 (GRCm39) missense possibly damaging 0.74
R9233:Fcgbpl1 UTSW 7 27,839,519 (GRCm39) missense possibly damaging 0.83
R9330:Fcgbpl1 UTSW 7 27,856,410 (GRCm39) missense probably benign 0.02
R9426:Fcgbpl1 UTSW 7 27,843,281 (GRCm39) missense possibly damaging 0.92
R9477:Fcgbpl1 UTSW 7 27,852,265 (GRCm39) missense probably damaging 1.00
R9502:Fcgbpl1 UTSW 7 27,836,891 (GRCm39) missense probably benign 0.09
R9505:Fcgbpl1 UTSW 7 27,841,909 (GRCm39) nonsense probably null
R9601:Fcgbpl1 UTSW 7 27,853,805 (GRCm39) missense possibly damaging 0.78
R9630:Fcgbpl1 UTSW 7 27,836,624 (GRCm39) missense probably damaging 1.00
R9632:Fcgbpl1 UTSW 7 27,841,726 (GRCm39) missense probably benign
R9673:Fcgbpl1 UTSW 7 27,856,044 (GRCm39) missense probably benign 0.25
R9735:Fcgbpl1 UTSW 7 27,856,435 (GRCm39) missense probably damaging 1.00
Z1176:Fcgbpl1 UTSW 7 27,854,187 (GRCm39) missense probably benign 0.03
Z1176:Fcgbpl1 UTSW 7 27,841,811 (GRCm39) missense probably benign 0.06
Z1177:Fcgbpl1 UTSW 7 27,839,323 (GRCm39) missense probably benign 0.25
Z1186:Fcgbpl1 UTSW 7 27,856,411 (GRCm39) missense probably benign 0.01
Z1186:Fcgbpl1 UTSW 7 27,846,130 (GRCm39) missense probably benign 0.00
Z1186:Fcgbpl1 UTSW 7 27,830,997 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCCCAACTGCATGTGATG -3'
(R):5'- ACCACGGTGACATTGAAGTATTCAG -3'

Sequencing Primer
(F):5'- AACTGCATGTGATGGGCCC -3'
(R):5'- GTGACATTGAAGTATTCAGTCCCTG -3'
Posted On 2019-06-07