Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4378001:Lats1'

555004

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

PIT4378001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 7705605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 718 (V718G)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: V718G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: V718G

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: V718G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: V718G

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: V718G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 93.1%
3x: 90.8%
10x: 85.0%
20x: 72.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,015,207	L14P	probably damaging	Het
2310033P09Rik	T	C	11: 59,208,976	V100A	probably benign	Het
9530053A07Rik	G	A	7: 28,154,464	D1618N	possibly damaging	Het
Adamtsl1	T	C	4: 86,199,364	V188A	possibly damaging	Het
Aldh6a1	T	C	12: 84,441,872	D80G	probably benign	Het
Ankrd50	T	C	3: 38,455,263	Q62R	possibly damaging	Het
Arrdc1	T	A	2: 24,926,633	Y177F	probably damaging	Het
Asap1	C	T	15: 64,135,848	R384Q	probably damaging	Het
Atxn2l	A	T	7: 126,497,271	V433D	probably benign	Het
Bbs1	G	A	19: 4,891,675	A529V	probably benign	Het
Bbx	G	A	16: 50,280,473	R20*	probably null	Het
Bend5	T	C	4: 111,431,107	V106A	probably benign	Het
C1galt1	A	G	6: 7,863,944	N8S	probably benign	Het
Cdc42ep1	G	A	15: 78,849,680	D327N	possibly damaging	Het
Cep162	A	G	9: 87,217,145	S767P	probably benign	Het
Csmd1	T	C	8: 15,895,728	T3562A	probably damaging	Het
Dnah7a	A	G	1: 53,531,203	S1815P	probably damaging	Het
Ei24	A	T	9: 36,786,024	L136Q	probably damaging	Het
Extl2	T	G	3: 116,010,690	M1R	probably null	Het
Fam160a1	A	G	3: 85,730,551	L147P	probably damaging	Het
Fat3	T	C	9: 16,376,808	E473G	probably benign	Het
Fgfr1op	T	C	17: 8,182,273	S209P	probably damaging	Het
G6pc3	T	A	11: 102,190,001	W26R	probably damaging	Het
Hc	T	A	2: 35,031,864	Y610F	probably benign	Het
Hecw1	T	C	13: 14,377,783	D77G	probably damaging	Het
Hgf	T	C	5: 16,611,862	V497A	probably damaging	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Hyou1	A	C	9: 44,390,851	D968A	probably benign	Het
Jmjd1c	T	A	10: 67,229,913	S1525T	probably damaging	Het
Kcnc4	G	A	3: 107,447,563	T523I	probably benign	Het
Kcng1	C	T	2: 168,262,684	C414Y	probably damaging	Het
Klhdc10	T	C	6: 30,447,412	I204T	probably damaging	Het
Krt18	A	T	15: 102,029,923	T194S	probably benign	Het
Krt76	A	C	15: 101,892,407	N151K	probably damaging	Het
Krtap31-2	A	G	11: 99,936,716	T125A	possibly damaging	Het
Lama5	A	G	2: 180,189,445	V1807A	possibly damaging	Het
Mef2b	A	G	8: 70,164,260	K4E	probably damaging	Het
Mertk	T	C	2: 128,782,617		probably null	Het
Mroh8	A	G	2: 157,228,700	V577A	possibly damaging	Het
Mtcl1	T	G	17: 66,438,279	N381T	probably damaging	Het
Nfyc	T	A	4: 120,790,491		probably null	Het
Nol4	C	A	18: 23,039,876	W56L	probably damaging	Het
Notch2	A	T	3: 98,142,956	D1849V	probably damaging	Het
Olfr1406	T	C	1: 173,183,814	T207A	probably benign	Het
Olfr1436	A	G	19: 12,298,712	M140T	probably damaging	Het
Olfr284	A	G	15: 98,340,272	V239A	possibly damaging	Het
Olfr287	G	A	15: 98,207,571	T271I	probably damaging	Het
Olfr297	A	T	7: 86,527,098	T114S	possibly damaging	Het
Olfr733	T	C	14: 50,298,898	N137S	probably benign	Het
Olfr846	T	A	9: 19,361,175	Y60F	probably damaging	Het
Oxr1	G	A	15: 41,801,582	V138I	probably benign	Het
Pars2	A	G	4: 106,654,293	E424G	possibly damaging	Het
Peli2	C	A	14: 48,168,269	Y50*	probably null	Het
Plag1	T	A	4: 3,905,492	H66L	probably benign	Het
Psme4	T	C	11: 30,821,079		probably benign	Het
Robo1	A	T	16: 73,004,535	S1016C	probably damaging	Het
Rrbp1	A	G	2: 143,974,540	V723A	probably benign	Het
Sgip1	C	A	4: 102,921,083	D292E	unknown	Het
Skint4	T	A	4: 112,087,035	C23S	probably benign	Het
Slc22a28	A	C	19: 8,071,914	S323R	probably damaging	Het
Slc41a3	A	G	6: 90,640,909	T306A	probably benign	Het
Spata13	A	G	14: 60,749,996	M868V	probably damaging	Het
Spata6	T	G	4: 111,746,181	I31S	possibly damaging	Het
Sycp3	A	T	10: 88,466,504	K119*	probably null	Het
Tlk2	T	A	11: 105,281,220	S739T	unknown	Het
Trim10	T	C	17: 36,877,128	V412A	probably damaging	Het
Ttc3	T	A	16: 94,410,906	F377I	probably benign	Het
Uck1	T	A	2: 32,256,034	H283L	probably damaging	Het
Unc5a	T	C	13: 54,995,868	Y122H	possibly damaging	Het
Uncx	C	T	5: 139,544,622	R152*	probably null	Het
Usp44	A	G	10: 93,845,655		probably benign	Het
Vamp2	A	C	11: 69,089,738	D44A	probably benign	Het
Vmn2r83	A	G	10: 79,469,015	T20A	probably benign	Het
Vmn2r84	A	T	10: 130,385,915	I812N	probably damaging	Het
Vrtn	T	G	12: 84,649,169	L231R	probably damaging	Het
Wdr75	A	G	1: 45,820,173	T677A	probably damaging	Het
Xylt1	C	A	7: 117,548,865	S221R	possibly damaging	Het
Zscan22	A	G	7: 12,904,056	E125G	possibly damaging	Het
Zxdc	A	T	6: 90,373,716	H383L	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCTGCATTGTTTCTTAAGC -3'
(R):5'- GTCCATCACAAAGTACAAGTTGTCC -3'

Sequencing Primer
(F):5'- GCCTGCATTGTTTCTTAAGCTATGTC -3'
(R):5'- CCTTGTCCTGGAAAGAGTAGTAC -3'

Posted On

2019-06-07