Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4378001:Psme4'

555010

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4378001 (G1)

Quality Score

210.009

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 30821079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121892

Coding Region Coverage

1x: 93.1%
3x: 90.8%
10x: 85.0%
20x: 72.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,015,207	L14P	probably damaging	Het
2310033P09Rik	T	C	11: 59,208,976	V100A	probably benign	Het
9530053A07Rik	G	A	7: 28,154,464	D1618N	possibly damaging	Het
Adamtsl1	T	C	4: 86,199,364	V188A	possibly damaging	Het
Aldh6a1	T	C	12: 84,441,872	D80G	probably benign	Het
Ankrd50	T	C	3: 38,455,263	Q62R	possibly damaging	Het
Arrdc1	T	A	2: 24,926,633	Y177F	probably damaging	Het
Asap1	C	T	15: 64,135,848	R384Q	probably damaging	Het
Atxn2l	A	T	7: 126,497,271	V433D	probably benign	Het
Bbs1	G	A	19: 4,891,675	A529V	probably benign	Het
Bbx	G	A	16: 50,280,473	R20*	probably null	Het
Bend5	T	C	4: 111,431,107	V106A	probably benign	Het
C1galt1	A	G	6: 7,863,944	N8S	probably benign	Het
Cdc42ep1	G	A	15: 78,849,680	D327N	possibly damaging	Het
Cep162	A	G	9: 87,217,145	S767P	probably benign	Het
Csmd1	T	C	8: 15,895,728	T3562A	probably damaging	Het
Dnah7a	A	G	1: 53,531,203	S1815P	probably damaging	Het
Ei24	A	T	9: 36,786,024	L136Q	probably damaging	Het
Extl2	T	G	3: 116,010,690	M1R	probably null	Het
Fam160a1	A	G	3: 85,730,551	L147P	probably damaging	Het
Fat3	T	C	9: 16,376,808	E473G	probably benign	Het
Fgfr1op	T	C	17: 8,182,273	S209P	probably damaging	Het
G6pc3	T	A	11: 102,190,001	W26R	probably damaging	Het
Hc	T	A	2: 35,031,864	Y610F	probably benign	Het
Hecw1	T	C	13: 14,377,783	D77G	probably damaging	Het
Hgf	T	C	5: 16,611,862	V497A	probably damaging	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Hyou1	A	C	9: 44,390,851	D968A	probably benign	Het
Jmjd1c	T	A	10: 67,229,913	S1525T	probably damaging	Het
Kcnc4	G	A	3: 107,447,563	T523I	probably benign	Het
Kcng1	C	T	2: 168,262,684	C414Y	probably damaging	Het
Klhdc10	T	C	6: 30,447,412	I204T	probably damaging	Het
Krt18	A	T	15: 102,029,923	T194S	probably benign	Het
Krt76	A	C	15: 101,892,407	N151K	probably damaging	Het
Krtap31-2	A	G	11: 99,936,716	T125A	possibly damaging	Het
Lama5	A	G	2: 180,189,445	V1807A	possibly damaging	Het
Lats1	T	G	10: 7,705,605	V718G	probably damaging	Het
Mef2b	A	G	8: 70,164,260	K4E	probably damaging	Het
Mertk	T	C	2: 128,782,617		probably null	Het
Mroh8	A	G	2: 157,228,700	V577A	possibly damaging	Het
Mtcl1	T	G	17: 66,438,279	N381T	probably damaging	Het
Nfyc	T	A	4: 120,790,491		probably null	Het
Nol4	C	A	18: 23,039,876	W56L	probably damaging	Het
Notch2	A	T	3: 98,142,956	D1849V	probably damaging	Het
Olfr1406	T	C	1: 173,183,814	T207A	probably benign	Het
Olfr1436	A	G	19: 12,298,712	M140T	probably damaging	Het
Olfr284	A	G	15: 98,340,272	V239A	possibly damaging	Het
Olfr287	G	A	15: 98,207,571	T271I	probably damaging	Het
Olfr297	A	T	7: 86,527,098	T114S	possibly damaging	Het
Olfr733	T	C	14: 50,298,898	N137S	probably benign	Het
Olfr846	T	A	9: 19,361,175	Y60F	probably damaging	Het
Oxr1	G	A	15: 41,801,582	V138I	probably benign	Het
Pars2	A	G	4: 106,654,293	E424G	possibly damaging	Het
Peli2	C	A	14: 48,168,269	Y50*	probably null	Het
Plag1	T	A	4: 3,905,492	H66L	probably benign	Het
Robo1	A	T	16: 73,004,535	S1016C	probably damaging	Het
Rrbp1	A	G	2: 143,974,540	V723A	probably benign	Het
Sgip1	C	A	4: 102,921,083	D292E	unknown	Het
Skint4	T	A	4: 112,087,035	C23S	probably benign	Het
Slc22a28	A	C	19: 8,071,914	S323R	probably damaging	Het
Slc41a3	A	G	6: 90,640,909	T306A	probably benign	Het
Spata13	A	G	14: 60,749,996	M868V	probably damaging	Het
Spata6	T	G	4: 111,746,181	I31S	possibly damaging	Het
Sycp3	A	T	10: 88,466,504	K119*	probably null	Het
Tlk2	T	A	11: 105,281,220	S739T	unknown	Het
Trim10	T	C	17: 36,877,128	V412A	probably damaging	Het
Ttc3	T	A	16: 94,410,906	F377I	probably benign	Het
Uck1	T	A	2: 32,256,034	H283L	probably damaging	Het
Unc5a	T	C	13: 54,995,868	Y122H	possibly damaging	Het
Uncx	C	T	5: 139,544,622	R152*	probably null	Het
Usp44	A	G	10: 93,845,655		probably benign	Het
Vamp2	A	C	11: 69,089,738	D44A	probably benign	Het
Vmn2r83	A	G	10: 79,469,015	T20A	probably benign	Het
Vmn2r84	A	T	10: 130,385,915	I812N	probably damaging	Het
Vrtn	T	G	12: 84,649,169	L231R	probably damaging	Het
Wdr75	A	G	1: 45,820,173	T677A	probably damaging	Het
Xylt1	C	A	7: 117,548,865	S221R	possibly damaging	Het
Zscan22	A	G	7: 12,904,056	E125G	possibly damaging	Het
Zxdc	A	T	6: 90,373,716	H383L	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

Posted On

2019-06-07