Incidental Mutation 'PIT4378001:Aldh6a1'
ID 555016
Institutional Source Beutler Lab
Gene Symbol Aldh6a1
Ensembl Gene ENSMUSG00000021238
Gene Name aldehyde dehydrogenase family 6, subfamily A1
Synonyms Mmsdh, 1110038I05Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.214) question?
Stock # PIT4378001 (G1)
Quality Score 167.009
Status Not validated
Chromosome 12
Chromosomal Location 84477491-84497778 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84488646 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000082288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085192] [ENSMUST00000220491]
AlphaFold Q9EQ20
Predicted Effect probably benign
Transcript: ENSMUST00000085192
AA Change: D80G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000082288
Gene: ENSMUSG00000021238
AA Change: D80G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:Aldedh 48 512 1.9e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220491
AA Change: D55G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000221969
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded enzyme is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This enzyme catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Mutations in the human gene result in Methylmalonate Semialdehyde Dehydrogenase Deficiency, characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik T C 11: 59,099,802 (GRCm39) V100A probably benign Het
Adamtsl1 T C 4: 86,117,601 (GRCm39) V188A possibly damaging Het
Ankrd50 T C 3: 38,509,412 (GRCm39) Q62R possibly damaging Het
Aopep T C 13: 63,163,021 (GRCm39) L14P probably damaging Het
Arrdc1 T A 2: 24,816,645 (GRCm39) Y177F probably damaging Het
Asap1 C T 15: 64,007,697 (GRCm39) R384Q probably damaging Het
Atxn2l A T 7: 126,096,443 (GRCm39) V433D probably benign Het
Bbs1 G A 19: 4,941,703 (GRCm39) A529V probably benign Het
Bbx G A 16: 50,100,836 (GRCm39) R20* probably null Het
Bend5 T C 4: 111,288,304 (GRCm39) V106A probably benign Het
C1galt1 A G 6: 7,863,944 (GRCm39) N8S probably benign Het
Cdc42ep1 G A 15: 78,733,880 (GRCm39) D327N possibly damaging Het
Cep162 A G 9: 87,099,198 (GRCm39) S767P probably benign Het
Cep43 T C 17: 8,401,105 (GRCm39) S209P probably damaging Het
Csmd1 T C 8: 15,945,728 (GRCm39) T3562A probably damaging Het
Dnah7a A G 1: 53,570,362 (GRCm39) S1815P probably damaging Het
Ei24 A T 9: 36,697,320 (GRCm39) L136Q probably damaging Het
Extl2 T G 3: 115,804,339 (GRCm39) M1R probably null Het
Fat3 T C 9: 16,288,104 (GRCm39) E473G probably benign Het
Fcgbpl1 G A 7: 27,853,889 (GRCm39) D1618N possibly damaging Het
Fhip1a A G 3: 85,637,858 (GRCm39) L147P probably damaging Het
G6pc3 T A 11: 102,080,827 (GRCm39) W26R probably damaging Het
Hc T A 2: 34,921,876 (GRCm39) Y610F probably benign Het
Hecw1 T C 13: 14,552,368 (GRCm39) D77G probably damaging Het
Hgf T C 5: 16,816,860 (GRCm39) V497A probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hyou1 A C 9: 44,302,148 (GRCm39) D968A probably benign Het
Jmjd1c T A 10: 67,065,692 (GRCm39) S1525T probably damaging Het
Kcnc4 G A 3: 107,354,879 (GRCm39) T523I probably benign Het
Kcng1 C T 2: 168,104,604 (GRCm39) C414Y probably damaging Het
Klhdc10 T C 6: 30,447,411 (GRCm39) I204T probably damaging Het
Krt18 A T 15: 101,938,358 (GRCm39) T194S probably benign Het
Krt76 A C 15: 101,800,842 (GRCm39) N151K probably damaging Het
Krtap31-2 A G 11: 99,827,542 (GRCm39) T125A possibly damaging Het
Lama5 A G 2: 179,831,238 (GRCm39) V1807A possibly damaging Het
Lats1 T G 10: 7,581,369 (GRCm39) V718G probably damaging Het
Mef2b A G 8: 70,616,910 (GRCm39) K4E probably damaging Het
Mertk T C 2: 128,624,537 (GRCm39) probably null Het
Mroh8 A G 2: 157,070,620 (GRCm39) V577A possibly damaging Het
Mtcl1 T G 17: 66,745,274 (GRCm39) N381T probably damaging Het
Nfyc T A 4: 120,647,688 (GRCm39) probably null Het
Nol4 C A 18: 23,172,933 (GRCm39) W56L probably damaging Het
Notch2 A T 3: 98,050,272 (GRCm39) D1849V probably damaging Het
Or10ad1 G A 15: 98,105,452 (GRCm39) T271I probably damaging Het
Or10j7 T C 1: 173,011,381 (GRCm39) T207A probably benign Het
Or14c45 A T 7: 86,176,306 (GRCm39) T114S possibly damaging Het
Or4n4b T C 14: 50,536,355 (GRCm39) N137S probably benign Het
Or5an10 A G 19: 12,276,076 (GRCm39) M140T probably damaging Het
Or7g28 T A 9: 19,272,471 (GRCm39) Y60F probably damaging Het
Or8s5 A G 15: 98,238,153 (GRCm39) V239A possibly damaging Het
Oxr1 G A 15: 41,664,978 (GRCm39) V138I probably benign Het
Pars2 A G 4: 106,511,490 (GRCm39) E424G possibly damaging Het
Peli2 C A 14: 48,405,726 (GRCm39) Y50* probably null Het
Plag1 T A 4: 3,905,492 (GRCm39) H66L probably benign Het
Psme4 T C 11: 30,771,079 (GRCm39) probably benign Het
Robo1 A T 16: 72,801,423 (GRCm39) S1016C probably damaging Het
Rrbp1 A G 2: 143,816,460 (GRCm39) V723A probably benign Het
Sgip1 C A 4: 102,778,280 (GRCm39) D292E unknown Het
Skint4 T A 4: 111,944,232 (GRCm39) C23S probably benign Het
Slc22a28 A C 19: 8,049,279 (GRCm39) S323R probably damaging Het
Slc41a3 A G 6: 90,617,891 (GRCm39) T306A probably benign Het
Spata13 A G 14: 60,987,445 (GRCm39) M868V probably damaging Het
Spata6 T G 4: 111,603,378 (GRCm39) I31S possibly damaging Het
Sycp3 A T 10: 88,302,366 (GRCm39) K119* probably null Het
Tlk2 T A 11: 105,172,046 (GRCm39) S739T unknown Het
Trim10 T C 17: 37,188,020 (GRCm39) V412A probably damaging Het
Ttc3 T A 16: 94,211,765 (GRCm39) F377I probably benign Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Unc5a T C 13: 55,143,681 (GRCm39) Y122H possibly damaging Het
Uncx C T 5: 139,530,377 (GRCm39) R152* probably null Het
Usp44 A G 10: 93,681,517 (GRCm39) probably benign Het
Vamp2 A C 11: 68,980,564 (GRCm39) D44A probably benign Het
Vmn2r83 A G 10: 79,304,849 (GRCm39) T20A probably benign Het
Vmn2r84 A T 10: 130,221,784 (GRCm39) I812N probably damaging Het
Vrtn T G 12: 84,695,943 (GRCm39) L231R probably damaging Het
Wdr75 A G 1: 45,859,333 (GRCm39) T677A probably damaging Het
Xylt1 C A 7: 117,148,100 (GRCm39) S221R possibly damaging Het
Zscan22 A G 7: 12,637,983 (GRCm39) E125G possibly damaging Het
Zxdc A T 6: 90,350,698 (GRCm39) H383L probably damaging Het
Other mutations in Aldh6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Aldh6a1 APN 12 84,486,312 (GRCm39) missense probably damaging 1.00
IGL02213:Aldh6a1 APN 12 84,479,326 (GRCm39) intron probably benign
IGL02489:Aldh6a1 APN 12 84,480,746 (GRCm39) missense possibly damaging 0.66
IGL02806:Aldh6a1 APN 12 84,486,414 (GRCm39) missense probably damaging 1.00
IGL02930:Aldh6a1 APN 12 84,480,756 (GRCm39) missense possibly damaging 0.78
IGL03183:Aldh6a1 APN 12 84,483,214 (GRCm39) splice site probably null
R0015:Aldh6a1 UTSW 12 84,488,554 (GRCm39) missense probably damaging 1.00
R0506:Aldh6a1 UTSW 12 84,480,300 (GRCm39) missense probably damaging 1.00
R1458:Aldh6a1 UTSW 12 84,486,437 (GRCm39) missense probably null 0.01
R1468:Aldh6a1 UTSW 12 84,488,544 (GRCm39) missense possibly damaging 0.82
R1468:Aldh6a1 UTSW 12 84,488,544 (GRCm39) missense possibly damaging 0.82
R1579:Aldh6a1 UTSW 12 84,488,622 (GRCm39) missense possibly damaging 0.83
R2300:Aldh6a1 UTSW 12 84,486,303 (GRCm39) missense probably damaging 1.00
R4351:Aldh6a1 UTSW 12 84,490,535 (GRCm39) missense probably benign 0.00
R4447:Aldh6a1 UTSW 12 84,486,483 (GRCm39) missense possibly damaging 0.73
R5205:Aldh6a1 UTSW 12 84,486,418 (GRCm39) missense probably damaging 1.00
R5242:Aldh6a1 UTSW 12 84,483,157 (GRCm39) missense probably damaging 1.00
R5443:Aldh6a1 UTSW 12 84,484,745 (GRCm39) splice site probably null
R6849:Aldh6a1 UTSW 12 84,490,561 (GRCm39) missense probably benign 0.00
R7001:Aldh6a1 UTSW 12 84,488,662 (GRCm39) missense probably damaging 1.00
R7182:Aldh6a1 UTSW 12 84,488,605 (GRCm39) missense probably benign 0.19
R7417:Aldh6a1 UTSW 12 84,488,556 (GRCm39) missense probably benign 0.01
R7492:Aldh6a1 UTSW 12 84,483,640 (GRCm39) missense probably damaging 1.00
R7749:Aldh6a1 UTSW 12 84,488,855 (GRCm39) missense probably benign 0.00
R8511:Aldh6a1 UTSW 12 84,480,745 (GRCm39) missense possibly damaging 0.93
R9572:Aldh6a1 UTSW 12 84,487,017 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATGTCCTTCTACGTTGTAGAG -3'
(R):5'- GGGGACTTAAACCTGCTAACC -3'

Sequencing Primer
(F):5'- CTACGTTGTAGAGTTAGTGAGGACAG -3'
(R):5'- CCTGCTAACCTAGAATTTTGGGAGC -3'
Posted On 2019-06-07