Incidental Mutation 'PIT4378001:Olfr733'
ID555022
Institutional Source Beutler Lab
Gene Symbol Olfr733
Ensembl Gene ENSMUSG00000090874
Gene Nameolfactory receptor 733
SynonymsMOR241-2, GA_x6K02T2PMLR-5992342-5991416
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #PIT4378001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50295891-50301522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50298898 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 137 (N137S)
Ref Sequence ENSEMBL: ENSMUSP00000149085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163469] [ENSMUST00000214372] [ENSMUST00000214756] [ENSMUST00000216195]
Predicted Effect probably benign
Transcript: ENSMUST00000163469
AA Change: N137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128332
Gene: ENSMUSG00000090874
AA Change: N137S

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 6.4e-41 PFAM
Pfam:7tm_1 41 288 1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214372
AA Change: N137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214756
AA Change: N137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216195
AA Change: N137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,015,207 L14P probably damaging Het
2310033P09Rik T C 11: 59,208,976 V100A probably benign Het
9530053A07Rik G A 7: 28,154,464 D1618N possibly damaging Het
Adamtsl1 T C 4: 86,199,364 V188A possibly damaging Het
Aldh6a1 T C 12: 84,441,872 D80G probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Arrdc1 T A 2: 24,926,633 Y177F probably damaging Het
Asap1 C T 15: 64,135,848 R384Q probably damaging Het
Atxn2l A T 7: 126,497,271 V433D probably benign Het
Bbs1 G A 19: 4,891,675 A529V probably benign Het
Bbx G A 16: 50,280,473 R20* probably null Het
Bend5 T C 4: 111,431,107 V106A probably benign Het
C1galt1 A G 6: 7,863,944 N8S probably benign Het
Cdc42ep1 G A 15: 78,849,680 D327N possibly damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Csmd1 T C 8: 15,895,728 T3562A probably damaging Het
Dnah7a A G 1: 53,531,203 S1815P probably damaging Het
Ei24 A T 9: 36,786,024 L136Q probably damaging Het
Extl2 T G 3: 116,010,690 M1R probably null Het
Fam160a1 A G 3: 85,730,551 L147P probably damaging Het
Fat3 T C 9: 16,376,808 E473G probably benign Het
Fgfr1op T C 17: 8,182,273 S209P probably damaging Het
G6pc3 T A 11: 102,190,001 W26R probably damaging Het
Hc T A 2: 35,031,864 Y610F probably benign Het
Hecw1 T C 13: 14,377,783 D77G probably damaging Het
Hgf T C 5: 16,611,862 V497A probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hyou1 A C 9: 44,390,851 D968A probably benign Het
Jmjd1c T A 10: 67,229,913 S1525T probably damaging Het
Kcnc4 G A 3: 107,447,563 T523I probably benign Het
Kcng1 C T 2: 168,262,684 C414Y probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Krt18 A T 15: 102,029,923 T194S probably benign Het
Krt76 A C 15: 101,892,407 N151K probably damaging Het
Krtap31-2 A G 11: 99,936,716 T125A possibly damaging Het
Lama5 A G 2: 180,189,445 V1807A possibly damaging Het
Lats1 T G 10: 7,705,605 V718G probably damaging Het
Mef2b A G 8: 70,164,260 K4E probably damaging Het
Mertk T C 2: 128,782,617 probably null Het
Mroh8 A G 2: 157,228,700 V577A possibly damaging Het
Mtcl1 T G 17: 66,438,279 N381T probably damaging Het
Nfyc T A 4: 120,790,491 probably null Het
Nol4 C A 18: 23,039,876 W56L probably damaging Het
Notch2 A T 3: 98,142,956 D1849V probably damaging Het
Olfr1406 T C 1: 173,183,814 T207A probably benign Het
Olfr1436 A G 19: 12,298,712 M140T probably damaging Het
Olfr284 A G 15: 98,340,272 V239A possibly damaging Het
Olfr287 G A 15: 98,207,571 T271I probably damaging Het
Olfr297 A T 7: 86,527,098 T114S possibly damaging Het
Olfr846 T A 9: 19,361,175 Y60F probably damaging Het
Oxr1 G A 15: 41,801,582 V138I probably benign Het
Pars2 A G 4: 106,654,293 E424G possibly damaging Het
Peli2 C A 14: 48,168,269 Y50* probably null Het
Plag1 T A 4: 3,905,492 H66L probably benign Het
Psme4 T C 11: 30,821,079 probably benign Het
Robo1 A T 16: 73,004,535 S1016C probably damaging Het
Rrbp1 A G 2: 143,974,540 V723A probably benign Het
Sgip1 C A 4: 102,921,083 D292E unknown Het
Skint4 T A 4: 112,087,035 C23S probably benign Het
Slc22a28 A C 19: 8,071,914 S323R probably damaging Het
Slc41a3 A G 6: 90,640,909 T306A probably benign Het
Spata13 A G 14: 60,749,996 M868V probably damaging Het
Spata6 T G 4: 111,746,181 I31S possibly damaging Het
Sycp3 A T 10: 88,466,504 K119* probably null Het
Tlk2 T A 11: 105,281,220 S739T unknown Het
Trim10 T C 17: 36,877,128 V412A probably damaging Het
Ttc3 T A 16: 94,410,906 F377I probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Unc5a T C 13: 54,995,868 Y122H possibly damaging Het
Uncx C T 5: 139,544,622 R152* probably null Het
Usp44 A G 10: 93,845,655 probably benign Het
Vamp2 A C 11: 69,089,738 D44A probably benign Het
Vmn2r83 A G 10: 79,469,015 T20A probably benign Het
Vmn2r84 A T 10: 130,385,915 I812N probably damaging Het
Vrtn T G 12: 84,649,169 L231R probably damaging Het
Wdr75 A G 1: 45,820,173 T677A probably damaging Het
Xylt1 C A 7: 117,548,865 S221R possibly damaging Het
Zscan22 A G 7: 12,904,056 E125G possibly damaging Het
Zxdc A T 6: 90,373,716 H383L probably damaging Het
Other mutations in Olfr733
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr733 APN 14 50298512 missense probably benign 0.00
IGL02247:Olfr733 APN 14 50299114 missense probably damaging 1.00
IGL02307:Olfr733 APN 14 50298838 missense probably damaging 1.00
IGL02492:Olfr733 APN 14 50298603 missense probably damaging 1.00
R0544:Olfr733 UTSW 14 50298682 missense probably benign 0.20
R1603:Olfr733 UTSW 14 50299034 missense possibly damaging 0.95
R1881:Olfr733 UTSW 14 50299015 missense probably damaging 1.00
R3731:Olfr733 UTSW 14 50298505 missense probably damaging 1.00
R4271:Olfr733 UTSW 14 50298451 missense probably damaging 1.00
R4512:Olfr733 UTSW 14 50298996 missense probably damaging 1.00
R5601:Olfr733 UTSW 14 50298861 missense probably damaging 1.00
R6468:Olfr733 UTSW 14 50298467 missense probably benign 0.02
R6614:Olfr733 UTSW 14 50299037 missense probably benign 0.00
R7013:Olfr733 UTSW 14 50299199 missense probably damaging 0.99
R7083:Olfr733 UTSW 14 50299279 missense possibly damaging 0.81
R7274:Olfr733 UTSW 14 50298422 missense probably benign 0.01
R7493:Olfr733 UTSW 14 50298824 missense probably benign 0.02
R7653:Olfr733 UTSW 14 50299147 missense possibly damaging 0.82
R7659:Olfr733 UTSW 14 50299241 missense probably benign 0.00
R7885:Olfr733 UTSW 14 50298584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCTCGACTGCAAAGGTG -3'
(R):5'- AATTTGGCCTTCCTGGATGC -3'

Sequencing Primer
(F):5'- ATCTCGACTGCAAAGGTGTCTGTAC -3'
(R):5'- CCTTCATTGTGGCTCCTAGGATG -3'
Posted On2019-06-07