Incidental Mutation 'PIT4378001:Trim10'
ID 555035
Institutional Source Beutler Lab
Gene Symbol Trim10
Ensembl Gene ENSMUSG00000073400
Gene Name tripartite motif-containing 10
Synonyms Rnf9, Herf1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # PIT4378001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37180466-37188725 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37188020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 412 (V412A)
Ref Sequence ENSEMBL: ENSMUSP00000057928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060524] [ENSMUST00000087158] [ENSMUST00000172711]
AlphaFold Q9WUH5
Predicted Effect probably damaging
Transcript: ENSMUST00000060524
AA Change: V412A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400
AA Change: V412A

DomainStartEndE-ValueType
RING 16 60 1.2e-7 SMART
BBOX 94 135 5.38e-10 SMART
coiled coil region 152 175 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
PRY 309 361 1.04e-25 SMART
SPRY 362 485 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087158
SMART Domains Protein: ENSMUSP00000084400
Gene: ENSMUSG00000073399

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 1.1e-6 PFAM
coiled coil region 106 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172711
SMART Domains Protein: ENSMUSP00000133581
Gene: ENSMUSG00000073399

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 3.4e-7 PFAM
coiled coil region 106 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic bodies. Studies in mice suggest that this protein plays a role in terminal differentiation of erythroid cells. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik T C 11: 59,099,802 (GRCm39) V100A probably benign Het
Adamtsl1 T C 4: 86,117,601 (GRCm39) V188A possibly damaging Het
Aldh6a1 T C 12: 84,488,646 (GRCm39) D80G probably benign Het
Ankrd50 T C 3: 38,509,412 (GRCm39) Q62R possibly damaging Het
Aopep T C 13: 63,163,021 (GRCm39) L14P probably damaging Het
Arrdc1 T A 2: 24,816,645 (GRCm39) Y177F probably damaging Het
Asap1 C T 15: 64,007,697 (GRCm39) R384Q probably damaging Het
Atxn2l A T 7: 126,096,443 (GRCm39) V433D probably benign Het
Bbs1 G A 19: 4,941,703 (GRCm39) A529V probably benign Het
Bbx G A 16: 50,100,836 (GRCm39) R20* probably null Het
Bend5 T C 4: 111,288,304 (GRCm39) V106A probably benign Het
C1galt1 A G 6: 7,863,944 (GRCm39) N8S probably benign Het
Cdc42ep1 G A 15: 78,733,880 (GRCm39) D327N possibly damaging Het
Cep162 A G 9: 87,099,198 (GRCm39) S767P probably benign Het
Cep43 T C 17: 8,401,105 (GRCm39) S209P probably damaging Het
Csmd1 T C 8: 15,945,728 (GRCm39) T3562A probably damaging Het
Dnah7a A G 1: 53,570,362 (GRCm39) S1815P probably damaging Het
Ei24 A T 9: 36,697,320 (GRCm39) L136Q probably damaging Het
Extl2 T G 3: 115,804,339 (GRCm39) M1R probably null Het
Fat3 T C 9: 16,288,104 (GRCm39) E473G probably benign Het
Fcgbpl1 G A 7: 27,853,889 (GRCm39) D1618N possibly damaging Het
Fhip1a A G 3: 85,637,858 (GRCm39) L147P probably damaging Het
G6pc3 T A 11: 102,080,827 (GRCm39) W26R probably damaging Het
Hc T A 2: 34,921,876 (GRCm39) Y610F probably benign Het
Hecw1 T C 13: 14,552,368 (GRCm39) D77G probably damaging Het
Hgf T C 5: 16,816,860 (GRCm39) V497A probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hyou1 A C 9: 44,302,148 (GRCm39) D968A probably benign Het
Jmjd1c T A 10: 67,065,692 (GRCm39) S1525T probably damaging Het
Kcnc4 G A 3: 107,354,879 (GRCm39) T523I probably benign Het
Kcng1 C T 2: 168,104,604 (GRCm39) C414Y probably damaging Het
Klhdc10 T C 6: 30,447,411 (GRCm39) I204T probably damaging Het
Krt18 A T 15: 101,938,358 (GRCm39) T194S probably benign Het
Krt76 A C 15: 101,800,842 (GRCm39) N151K probably damaging Het
Krtap31-2 A G 11: 99,827,542 (GRCm39) T125A possibly damaging Het
Lama5 A G 2: 179,831,238 (GRCm39) V1807A possibly damaging Het
Lats1 T G 10: 7,581,369 (GRCm39) V718G probably damaging Het
Mef2b A G 8: 70,616,910 (GRCm39) K4E probably damaging Het
Mertk T C 2: 128,624,537 (GRCm39) probably null Het
Mroh8 A G 2: 157,070,620 (GRCm39) V577A possibly damaging Het
Mtcl1 T G 17: 66,745,274 (GRCm39) N381T probably damaging Het
Nfyc T A 4: 120,647,688 (GRCm39) probably null Het
Nol4 C A 18: 23,172,933 (GRCm39) W56L probably damaging Het
Notch2 A T 3: 98,050,272 (GRCm39) D1849V probably damaging Het
Or10ad1 G A 15: 98,105,452 (GRCm39) T271I probably damaging Het
Or10j7 T C 1: 173,011,381 (GRCm39) T207A probably benign Het
Or14c45 A T 7: 86,176,306 (GRCm39) T114S possibly damaging Het
Or4n4b T C 14: 50,536,355 (GRCm39) N137S probably benign Het
Or5an10 A G 19: 12,276,076 (GRCm39) M140T probably damaging Het
Or7g28 T A 9: 19,272,471 (GRCm39) Y60F probably damaging Het
Or8s5 A G 15: 98,238,153 (GRCm39) V239A possibly damaging Het
Oxr1 G A 15: 41,664,978 (GRCm39) V138I probably benign Het
Pars2 A G 4: 106,511,490 (GRCm39) E424G possibly damaging Het
Peli2 C A 14: 48,405,726 (GRCm39) Y50* probably null Het
Plag1 T A 4: 3,905,492 (GRCm39) H66L probably benign Het
Psme4 T C 11: 30,771,079 (GRCm39) probably benign Het
Robo1 A T 16: 72,801,423 (GRCm39) S1016C probably damaging Het
Rrbp1 A G 2: 143,816,460 (GRCm39) V723A probably benign Het
Sgip1 C A 4: 102,778,280 (GRCm39) D292E unknown Het
Skint4 T A 4: 111,944,232 (GRCm39) C23S probably benign Het
Slc22a28 A C 19: 8,049,279 (GRCm39) S323R probably damaging Het
Slc41a3 A G 6: 90,617,891 (GRCm39) T306A probably benign Het
Spata13 A G 14: 60,987,445 (GRCm39) M868V probably damaging Het
Spata6 T G 4: 111,603,378 (GRCm39) I31S possibly damaging Het
Sycp3 A T 10: 88,302,366 (GRCm39) K119* probably null Het
Tlk2 T A 11: 105,172,046 (GRCm39) S739T unknown Het
Ttc3 T A 16: 94,211,765 (GRCm39) F377I probably benign Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Unc5a T C 13: 55,143,681 (GRCm39) Y122H possibly damaging Het
Uncx C T 5: 139,530,377 (GRCm39) R152* probably null Het
Usp44 A G 10: 93,681,517 (GRCm39) probably benign Het
Vamp2 A C 11: 68,980,564 (GRCm39) D44A probably benign Het
Vmn2r83 A G 10: 79,304,849 (GRCm39) T20A probably benign Het
Vmn2r84 A T 10: 130,221,784 (GRCm39) I812N probably damaging Het
Vrtn T G 12: 84,695,943 (GRCm39) L231R probably damaging Het
Wdr75 A G 1: 45,859,333 (GRCm39) T677A probably damaging Het
Xylt1 C A 7: 117,148,100 (GRCm39) S221R possibly damaging Het
Zscan22 A G 7: 12,637,983 (GRCm39) E125G possibly damaging Het
Zxdc A T 6: 90,350,698 (GRCm39) H383L probably damaging Het
Other mutations in Trim10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Trim10 APN 17 37,188,140 (GRCm39) missense probably benign 0.03
IGL00501:Trim10 APN 17 37,187,939 (GRCm39) missense probably benign 0.08
IGL00846:Trim10 APN 17 37,182,584 (GRCm39) missense probably damaging 1.00
IGL01536:Trim10 APN 17 37,188,180 (GRCm39) splice site probably null
IGL02814:Trim10 APN 17 37,188,228 (GRCm39) nonsense probably null
IGL03135:Trim10 APN 17 37,185,113 (GRCm39) missense possibly damaging 0.78
IGL03144:Trim10 APN 17 37,187,740 (GRCm39) missense probably damaging 1.00
IGL03298:Trim10 APN 17 37,187,917 (GRCm39) missense possibly damaging 0.87
R0102:Trim10 UTSW 17 37,181,074 (GRCm39) missense probably damaging 1.00
R0102:Trim10 UTSW 17 37,181,074 (GRCm39) missense probably damaging 1.00
R0834:Trim10 UTSW 17 37,183,283 (GRCm39) missense probably benign 0.00
R1517:Trim10 UTSW 17 37,183,346 (GRCm39) missense probably damaging 1.00
R1691:Trim10 UTSW 17 37,187,791 (GRCm39) missense probably damaging 1.00
R1696:Trim10 UTSW 17 37,188,073 (GRCm39) nonsense probably null
R2149:Trim10 UTSW 17 37,187,906 (GRCm39) missense probably benign 0.18
R3153:Trim10 UTSW 17 37,182,580 (GRCm39) missense probably damaging 1.00
R3154:Trim10 UTSW 17 37,182,580 (GRCm39) missense probably damaging 1.00
R5156:Trim10 UTSW 17 37,187,948 (GRCm39) missense probably damaging 0.99
R5327:Trim10 UTSW 17 37,181,081 (GRCm39) missense probably damaging 1.00
R5361:Trim10 UTSW 17 37,186,328 (GRCm39) missense probably benign 0.03
R5758:Trim10 UTSW 17 37,188,044 (GRCm39) missense possibly damaging 0.80
R5764:Trim10 UTSW 17 37,181,073 (GRCm39) missense probably damaging 0.97
R6032:Trim10 UTSW 17 37,182,606 (GRCm39) missense possibly damaging 0.87
R6032:Trim10 UTSW 17 37,182,606 (GRCm39) missense possibly damaging 0.87
R6179:Trim10 UTSW 17 37,187,923 (GRCm39) missense probably damaging 1.00
R6709:Trim10 UTSW 17 37,183,262 (GRCm39) missense probably damaging 0.99
R7172:Trim10 UTSW 17 37,180,955 (GRCm39) missense possibly damaging 0.78
R7197:Trim10 UTSW 17 37,187,846 (GRCm39) missense probably damaging 1.00
R7390:Trim10 UTSW 17 37,180,773 (GRCm39) start codon destroyed probably null 0.98
R7391:Trim10 UTSW 17 37,180,773 (GRCm39) start codon destroyed probably null 0.98
R7696:Trim10 UTSW 17 37,182,644 (GRCm39) missense probably damaging 1.00
R8830:Trim10 UTSW 17 37,180,846 (GRCm39) missense probably damaging 1.00
R8867:Trim10 UTSW 17 37,181,048 (GRCm39) missense probably benign 0.00
R8970:Trim10 UTSW 17 37,184,168 (GRCm39) missense probably benign 0.00
R9376:Trim10 UTSW 17 37,184,168 (GRCm39) missense probably benign 0.00
R9635:Trim10 UTSW 17 37,187,890 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGTTCTGGCCCAATGTG -3'
(R):5'- AAACTGCACCTTCCTGACAG -3'

Sequencing Primer
(F):5'- CTGGCCCAATGTGGTTTTACAG -3'
(R):5'- GGGAAAAACTGGACCCTCTGC -3'
Posted On 2019-06-07