Incidental Mutation 'PIT4434001:Fbxw20'
ID555066
Institutional Source Beutler Lab
Gene Symbol Fbxw20
Ensembl Gene ENSMUSG00000061701
Gene NameF-box and WD-40 domain protein 20
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #PIT4434001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109217432-109234754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109223432 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 278 (S278P)
Ref Sequence ENSEMBL: ENSMUSP00000078503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079548] [ENSMUST00000197329]
Predicted Effect probably damaging
Transcript: ENSMUST00000079548
AA Change: S278P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078503
Gene: ENSMUSG00000061701
AA Change: S278P

DomainStartEndE-ValueType
FBOX 5 45 2.37e-6 SMART
SCOP:d1tbga_ 116 249 5e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197329
AA Change: S208P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143126
Gene: ENSMUSG00000061701
AA Change: S208P

DomainStartEndE-ValueType
FBOX 5 45 1.5e-8 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik T A 11: 117,806,043 D196E probably benign Het
Abcb5 G A 12: 118,890,687 S831F probably damaging Het
Alg2 C A 4: 47,474,076 A71S probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Ano1 A G 7: 144,610,895 V664A probably benign Het
Bbox1 A C 2: 110,275,634 D188E probably benign Het
Bmi1 C T 2: 18,684,231 T242M probably benign Het
C4bp A G 1: 130,657,210 F30L probably benign Het
Carmil3 A G 14: 55,494,688 N214S probably null Het
Cep162 C A 9: 87,193,648 K1310N probably damaging Het
Cfap74 G A 4: 155,463,964 V21M unknown Het
Copa A G 1: 172,106,175 D401G probably benign Het
Cyp4f14 A G 17: 32,906,130 V439A possibly damaging Het
Ddhd1 A C 14: 45,610,605 N569K possibly damaging Het
Dennd5a A G 7: 109,933,624 L313P probably damaging Het
Eri2 A G 7: 119,786,301 F326L probably benign Het
Fam135a A T 1: 24,029,195 H864Q probably benign Het
Fat3 C T 9: 15,996,316 V2797I probably benign Het
Fbn2 T C 18: 58,096,062 D692G probably damaging Het
Gna12 A T 5: 140,761,018 V224E probably damaging Het
Grn C T 11: 102,435,940 H482Y possibly damaging Het
Igkv7-33 A G 6: 70,058,813 Y62H possibly damaging Het
Kdm4c A G 4: 74,271,332 T95A probably benign Het
Lrp3 T C 7: 35,203,995 T309A probably damaging Het
Map3k2 C A 18: 32,210,035 D279E possibly damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Mcpt9 A G 14: 56,029,229 S14P probably benign Het
Olfr1358 T C 10: 78,519,715 F36L possibly damaging Het
Olfr570 T C 7: 102,900,630 F88L probably benign Het
Olfr622 A C 7: 103,639,847 C98G probably damaging Het
Otud7b G A 3: 96,140,465 R45H probably damaging Het
Pcdhb17 A G 18: 37,485,651 N165D probably damaging Het
Pogz A G 3: 94,872,370 T538A probably damaging Het
Prlr A G 15: 10,328,372 E311G probably damaging Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Raet1d A T 10: 22,371,534 K170* probably null Het
Rufy2 A T 10: 62,991,066 Q128L possibly damaging Het
Svopl T C 6: 38,014,866 N360D possibly damaging Het
Syt4 A C 18: 31,440,331 L377W probably damaging Het
Taar7a A G 10: 23,993,421 F21L probably benign Het
Tax1bp3 T A 11: 73,180,804 M78K probably damaging Het
Top2b T C 14: 16,423,780 probably null Het
Trim52 A T 14: 106,107,298 D130V probably benign Het
Ttc1 T C 11: 43,745,128 Y96C probably damaging Het
Vmn2r49 T C 7: 9,976,835 T657A probably damaging Het
Vps13d A T 4: 145,155,247 F1259I Het
Zbtb18 A T 1: 177,448,423 T441S possibly damaging Het
Other mutations in Fbxw20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Fbxw20 APN 9 109234702 start codon destroyed probably damaging 0.97
IGL01764:Fbxw20 APN 9 109223359 missense possibly damaging 0.71
IGL02149:Fbxw20 APN 9 109233818 critical splice donor site probably null
IGL02307:Fbxw20 APN 9 109233533 missense possibly damaging 0.70
IGL02335:Fbxw20 APN 9 109223309 missense possibly damaging 0.91
IGL02338:Fbxw20 APN 9 109225978 missense probably benign 0.00
PIT4377001:Fbxw20 UTSW 9 109221727 missense probably benign 0.00
R0652:Fbxw20 UTSW 9 109232332 missense probably damaging 1.00
R1018:Fbxw20 UTSW 9 109221336 missense probably benign 0.03
R1114:Fbxw20 UTSW 9 109223482 missense probably damaging 1.00
R1596:Fbxw20 UTSW 9 109221300 missense probably damaging 1.00
R1692:Fbxw20 UTSW 9 109221709 missense possibly damaging 0.73
R1967:Fbxw20 UTSW 9 109217510 missense probably benign 0.00
R2055:Fbxw20 UTSW 9 109221374 missense probably damaging 0.99
R2224:Fbxw20 UTSW 9 109233582 missense possibly damaging 0.50
R4394:Fbxw20 UTSW 9 109232330 missense probably benign 0.00
R4617:Fbxw20 UTSW 9 109217563 missense probably damaging 1.00
R4858:Fbxw20 UTSW 9 109234695 missense possibly damaging 0.54
R5794:Fbxw20 UTSW 9 109223290 missense probably damaging 0.97
R5794:Fbxw20 UTSW 9 109233600 missense possibly damaging 0.95
R6090:Fbxw20 UTSW 9 109223363 missense probably benign 0.03
R7161:Fbxw20 UTSW 9 109225980 missense probably damaging 1.00
R7328:Fbxw20 UTSW 9 109232315 missense probably damaging 1.00
R8004:Fbxw20 UTSW 9 109221381 missense probably damaging 1.00
R8258:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
R8259:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
Z1177:Fbxw20 UTSW 9 109225887 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGATTTGGGGCGTATGAC -3'
(R):5'- GCAATGATTGTTCTGCCCTGTC -3'

Sequencing Primer
(F):5'- ACGTCATGTCTGGATTGAGAAC -3'
(R):5'- CCTGTCCTGGGTGAAGAAC -3'
Posted On2019-06-07