Incidental Mutation 'PIT4519001:Dpp7'
ID 555092
Institutional Source Beutler Lab
Gene Symbol Dpp7
Ensembl Gene ENSMUSG00000026958
Gene Name dipeptidylpeptidase 7
Synonyms QPP
Accession Numbers

Genbank: NM_031843.2; Ensembl: ENSMUST00000028332

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # PIT4519001 (G1)
Quality Score 162.009
Status Not validated
Chromosome 2
Chromosomal Location 25352276-25356359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25352448 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 498 (G498W)
Ref Sequence ENSEMBL: ENSMUSP00000028332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028332] [ENSMUST00000042390]
AlphaFold Q9ET22
Predicted Effect probably damaging
Transcript: ENSMUST00000028332
AA Change: G498W

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028332
Gene: ENSMUSG00000026958
AA Change: G498W

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Peptidase_S28 48 475 2.3e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042390
SMART Domains Protein: ENSMUSP00000036996
Gene: ENSMUSG00000036646

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 29 42 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
Pfam:Glyco_hydro_47 215 654 9.5e-167 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 84.7%
  • 20x: 70.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. The resting lymphocytes are maintained through suppression of apoptosis, a state which is disrupted by inhibition of this novel serine protease. The enzyme has strong sequence homology with prolylcarboxypeptidase and is active at both acidic and neutral pH. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,170,666 M803K probably benign Het
4930590J08Rik C A 6: 91,917,057 N218K probably damaging Het
Abcc2 G A 19: 43,819,397 V826M possibly damaging Het
Abcg2 T C 6: 58,674,807 S395P probably damaging Het
Adam1b C T 5: 121,501,947 G345D probably damaging Het
Alx4 T A 2: 93,675,428 C292S probably benign Het
Amd2 C A 10: 35,710,631 C310F possibly damaging Het
BC051665 A T 13: 60,784,175 S137T possibly damaging Het
Bmp1 A G 14: 70,490,029 F705L possibly damaging Het
Coil C T 11: 88,972,726 probably benign Het
Col6a6 G A 9: 105,732,263 P1609S probably benign Het
Cpt1b A T 15: 89,418,863 F633I probably damaging Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Defb4 A G 8: 19,198,736 R2G possibly damaging Het
Dll4 T C 2: 119,332,416 V506A probably benign Het
Dopey2 A G 16: 93,762,054 S563G probably benign Het
Fam210a A T 18: 68,275,949 S97T possibly damaging Het
Fastkd1 T A 2: 69,690,157 D767V probably damaging Het
Fgg A T 3: 83,012,939 N342Y probably damaging Het
Gimap6 T G 6: 48,708,061 R30S probably benign Het
Gm10840 T C 11: 106,161,133 V95A unknown Het
Herc3 T A 6: 58,876,811 I614N probably damaging Het
Kdr A T 5: 75,936,896 S1233R possibly damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Magi2 A T 5: 20,661,346 K1078N probably damaging Het
Meioc A T 11: 102,679,957 E838V probably damaging Het
Mmp20 A G 9: 7,628,301 K17E probably benign Het
Mtor C T 4: 148,524,500 R1538W probably damaging Het
Notch2 C T 3: 98,098,108 T296I probably damaging Het
Nup98 T C 7: 102,134,964 S1054G probably benign Het
Olfr1463 A C 19: 13,234,852 I201L probably benign Het
Olfr308 T C 7: 86,321,733 Y73C probably damaging Het
Olfr446 T C 6: 42,927,644 C138R probably damaging Het
Olfr455 T C 6: 42,538,600 T141A probably damaging Het
Pipox C A 11: 77,883,175 W205L probably damaging Het
Plin4 T G 17: 56,103,828 T1068P probably benign Het
Pou6f2 A G 13: 18,239,564 S209P unknown Het
Ptpdc1 T C 13: 48,583,156 T713A probably benign Het
Rgsl1 T C 1: 153,825,970 Y246C possibly damaging Het
Rnf19b C T 4: 129,075,653 A354V probably damaging Het
Rsph4a A G 10: 33,909,130 T346A probably benign Het
Rsrc2 T C 5: 123,745,072 T16A unknown Het
Scrn3 T C 2: 73,318,424 V113A possibly damaging Het
Scrn3 T A 2: 73,331,003 I311K possibly damaging Het
Sfmbt1 T C 14: 30,784,191 probably null Het
Sin3a A G 9: 57,095,456 I211V possibly damaging Het
Strn3 T C 12: 51,633,708 T370A probably benign Het
Sulf1 T G 1: 12,848,171 N786K probably damaging Het
Taf1b T A 12: 24,547,119 Y352* probably null Het
Tas2r120 T A 6: 132,657,334 N126K probably benign Het
Tjap1 C A 17: 46,261,506 R68L probably benign Het
Tnfsf12 C T 11: 69,695,404 R66Q probably benign Het
Traj45 A G 14: 54,172,846 D6G Het
Trappc9 T C 15: 72,953,094 T541A probably benign Het
Ttc29 A C 8: 78,325,477 E329A probably benign Het
Vmn1r117 T G 7: 20,883,235 D296A possibly damaging Het
Vmn1r203 A G 13: 22,524,595 N182S probably benign Het
Vps53 C A 11: 76,117,173 R287L probably damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Zfp608 T C 18: 54,946,711 N334S possibly damaging Het
Zfp648 A G 1: 154,204,941 H282R probably damaging Het
Other mutations in Dpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Dpp7 APN 2 25354613 missense probably benign 0.01
IGL02897:Dpp7 APN 2 25353672 missense probably damaging 1.00
IGL02992:Dpp7 APN 2 25354577 missense possibly damaging 0.65
IGL03069:Dpp7 APN 2 25355723 critical splice acceptor site probably null
1mM(1):Dpp7 UTSW 2 25356140 missense probably benign 0.05
R0051:Dpp7 UTSW 2 25356095 missense possibly damaging 0.80
R0051:Dpp7 UTSW 2 25356095 missense possibly damaging 0.80
R0900:Dpp7 UTSW 2 25356299 missense probably damaging 0.99
R1889:Dpp7 UTSW 2 25353679 splice site probably null
R1895:Dpp7 UTSW 2 25353679 splice site probably null
R2055:Dpp7 UTSW 2 25354478 missense possibly damaging 0.84
R4697:Dpp7 UTSW 2 25354919 missense probably benign 0.00
R4832:Dpp7 UTSW 2 25352386 unclassified probably benign
R4887:Dpp7 UTSW 2 25352758 critical splice acceptor site probably null
R5114:Dpp7 UTSW 2 25352737 missense possibly damaging 0.51
R6976:Dpp7 UTSW 2 25354824 critical splice acceptor site probably null
R7577:Dpp7 UTSW 2 25355591 missense probably benign
R8459:Dpp7 UTSW 2 25352538 missense probably damaging 1.00
R8486:Dpp7 UTSW 2 25352549 missense probably damaging 1.00
R8672:Dpp7 UTSW 2 25356121 missense probably benign 0.00
R8690:Dpp7 UTSW 2 25355633 missense probably damaging 1.00
X0058:Dpp7 UTSW 2 25354752 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAAGCTGTGTGCAGTGTTAC -3'
(R):5'- CATGATGCTGACCCTGTCTG -3'

Sequencing Primer
(F):5'- CATGCATGGATCCTACTAGACAAGG -3'
(R):5'- GCTTGCCAGCTGAGTATCC -3'
Posted On 2019-06-07