Incidental Mutation 'PIT4519001:Dll4'
ID555097
Institutional Source Beutler Lab
Gene Symbol Dll4
Ensembl Gene ENSMUSG00000027314
Gene Namedelta like canonical Notch ligand 4
SynonymsDelta4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4519001 (G1)
Quality Score203.009
Status Not validated
Chromosome2
Chromosomal Location119325784-119335962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119332416 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 506 (V506A)
Ref Sequence ENSEMBL: ENSMUSP00000099575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102517]
Predicted Effect probably benign
Transcript: ENSMUST00000102517
AA Change: V506A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099575
Gene: ENSMUSG00000027314
AA Change: V506A

DomainStartEndE-ValueType
Pfam:MNNL 27 92 7.3e-21 PFAM
low complexity region 139 150 N/A INTRINSIC
DSL 156 218 1.98e-23 SMART
EGF 222 252 5.62e0 SMART
EGF 253 283 5.79e-2 SMART
EGF_CA 285 323 1.38e-8 SMART
EGF_CA 329 361 5.36e-6 SMART
EGF 366 401 4.35e-6 SMART
EGF 406 439 1.44e-6 SMART
EGF_CA 441 477 2.33e-6 SMART
EGF 484 519 9.33e-6 SMART
transmembrane domain 530 552 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 84.7%
  • 20x: 70.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, absent vascular remodeling, small hearts, and embryonic growth retardation. Heterozygous null mice display background dependent partial or complete embryonic lethality, impaired vascular remodeling, and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,170,666 M803K probably benign Het
4930590J08Rik C A 6: 91,917,057 N218K probably damaging Het
Abcc2 G A 19: 43,819,397 V826M possibly damaging Het
Abcg2 T C 6: 58,674,807 S395P probably damaging Het
Adam1b C T 5: 121,501,947 G345D probably damaging Het
Alx4 T A 2: 93,675,428 C292S probably benign Het
Amd2 C A 10: 35,710,631 C310F possibly damaging Het
BC051665 A T 13: 60,784,175 S137T possibly damaging Het
Bmp1 A G 14: 70,490,029 F705L possibly damaging Het
Coil C T 11: 88,972,726 probably benign Het
Col6a6 G A 9: 105,732,263 P1609S probably benign Het
Cpt1b A T 15: 89,418,863 F633I probably damaging Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Defb4 A G 8: 19,198,736 R2G possibly damaging Het
Dopey2 A G 16: 93,762,054 S563G probably benign Het
Dpp7 C A 2: 25,352,448 G498W probably damaging Het
Fam210a A T 18: 68,275,949 S97T possibly damaging Het
Fastkd1 T A 2: 69,690,157 D767V probably damaging Het
Fgg A T 3: 83,012,939 N342Y probably damaging Het
Gimap6 T G 6: 48,708,061 R30S probably benign Het
Gm10840 T C 11: 106,161,133 V95A unknown Het
Herc3 T A 6: 58,876,811 I614N probably damaging Het
Kdr A T 5: 75,936,896 S1233R possibly damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Magi2 A T 5: 20,661,346 K1078N probably damaging Het
Meioc A T 11: 102,679,957 E838V probably damaging Het
Mmp20 A G 9: 7,628,301 K17E probably benign Het
Mtor C T 4: 148,524,500 R1538W probably damaging Het
Notch2 C T 3: 98,098,108 T296I probably damaging Het
Nup98 T C 7: 102,134,964 S1054G probably benign Het
Olfr1463 A C 19: 13,234,852 I201L probably benign Het
Olfr308 T C 7: 86,321,733 Y73C probably damaging Het
Olfr446 T C 6: 42,927,644 C138R probably damaging Het
Olfr455 T C 6: 42,538,600 T141A probably damaging Het
Pipox C A 11: 77,883,175 W205L probably damaging Het
Plin4 T G 17: 56,103,828 T1068P probably benign Het
Pou6f2 A G 13: 18,239,564 S209P unknown Het
Ptpdc1 T C 13: 48,583,156 T713A probably benign Het
Rgsl1 T C 1: 153,825,970 Y246C possibly damaging Het
Rnf19b C T 4: 129,075,653 A354V probably damaging Het
Rsph4a A G 10: 33,909,130 T346A probably benign Het
Rsrc2 T C 5: 123,745,072 T16A unknown Het
Scrn3 T C 2: 73,318,424 V113A possibly damaging Het
Scrn3 T A 2: 73,331,003 I311K possibly damaging Het
Sfmbt1 T C 14: 30,784,191 probably null Het
Sin3a A G 9: 57,095,456 I211V possibly damaging Het
Strn3 T C 12: 51,633,708 T370A probably benign Het
Sulf1 T G 1: 12,848,171 N786K probably damaging Het
Taf1b T A 12: 24,547,119 Y352* probably null Het
Tas2r120 T A 6: 132,657,334 N126K probably benign Het
Tjap1 C A 17: 46,261,506 R68L probably benign Het
Tnfsf12 C T 11: 69,695,404 R66Q probably benign Het
Traj45 A G 14: 54,172,846 D6G Het
Trappc9 T C 15: 72,953,094 T541A probably benign Het
Ttc29 A C 8: 78,325,477 E329A probably benign Het
Vmn1r117 T G 7: 20,883,235 D296A possibly damaging Het
Vmn1r203 A G 13: 22,524,595 N182S probably benign Het
Vps53 C A 11: 76,117,173 R287L probably damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Zfp608 T C 18: 54,946,711 N334S possibly damaging Het
Zfp648 A G 1: 154,204,941 H282R probably damaging Het
Other mutations in Dll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Dll4 APN 2 119331109 missense probably damaging 1.00
IGL01149:Dll4 APN 2 119332745 missense probably damaging 1.00
IGL02511:Dll4 APN 2 119326466 missense probably damaging 0.99
R0316:Dll4 UTSW 2 119331153 missense probably damaging 1.00
R0725:Dll4 UTSW 2 119332689 missense probably damaging 1.00
R0840:Dll4 UTSW 2 119326485 missense probably benign 0.01
R1014:Dll4 UTSW 2 119331157 missense probably damaging 1.00
R1650:Dll4 UTSW 2 119331130 missense probably damaging 1.00
R3813:Dll4 UTSW 2 119331029 missense possibly damaging 0.65
R3974:Dll4 UTSW 2 119334092 missense probably damaging 0.98
R5320:Dll4 UTSW 2 119326487 missense probably damaging 0.97
R6166:Dll4 UTSW 2 119334626 critical splice acceptor site probably null
R6305:Dll4 UTSW 2 119330657 missense probably benign 0.01
R6455:Dll4 UTSW 2 119333795 intron probably null
R6617:Dll4 UTSW 2 119327931 missense probably benign
R6843:Dll4 UTSW 2 119325994 start gained probably benign
R7204:Dll4 UTSW 2 119328573 missense probably damaging 0.98
R7251:Dll4 UTSW 2 119332292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGCGATTGTGCCCGAAG -3'
(R):5'- AAGTCTGACAGATTGTTCATGGC -3'

Sequencing Primer
(F):5'- ATTGTGCCCGAAGTCCCTGTG -3'
(R):5'- GACAGATTGTTCATGGCTTCCCTG -3'
Posted On2019-06-07