Incidental Mutation 'PIT4519001:Fgg'
ID 555098
Institutional Source Beutler Lab
Gene Symbol Fgg
Ensembl Gene ENSMUSG00000033860
Gene Name fibrinogen gamma chain
Synonyms gamma-fibrinogen, 3010002H13Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock # PIT4519001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 83007724-83015049 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83012939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 342 (N342Y)
Ref Sequence ENSEMBL: ENSMUSP00000141648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048486] [ENSMUST00000194175]
AlphaFold Q8VCM7
Predicted Effect probably damaging
Transcript: ENSMUST00000048486
AA Change: N342Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037018
Gene: ENSMUSG00000033860
AA Change: N342Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194175
AA Change: N342Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141648
Gene: ENSMUSG00000033860
AA Change: N342Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 84.7%
  • 20x: 70.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Mice lacking the encoded protein did not possess detectable amounts of plasma fibrinogen. Pregnant mice lacking the encoded protein die due to heavy bleeding during delivery. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. Alternate splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Pregnant homozygous null mice exhibit retarded embryo-placental development, spontaneous abortion, and maternal death through excessive uterine bleeding. Mutants expressing a truncated polypeptide show reduced platelet aggregation, increased bleeding time, and occasional fatal neonatal bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,170,666 M803K probably benign Het
4930590J08Rik C A 6: 91,917,057 N218K probably damaging Het
Abcc2 G A 19: 43,819,397 V826M possibly damaging Het
Abcg2 T C 6: 58,674,807 S395P probably damaging Het
Adam1b C T 5: 121,501,947 G345D probably damaging Het
Alx4 T A 2: 93,675,428 C292S probably benign Het
Amd2 C A 10: 35,710,631 C310F possibly damaging Het
BC051665 A T 13: 60,784,175 S137T possibly damaging Het
Bmp1 A G 14: 70,490,029 F705L possibly damaging Het
Coil C T 11: 88,972,726 probably benign Het
Col6a6 G A 9: 105,732,263 P1609S probably benign Het
Cpt1b A T 15: 89,418,863 F633I probably damaging Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Defb4 A G 8: 19,198,736 R2G possibly damaging Het
Dll4 T C 2: 119,332,416 V506A probably benign Het
Dopey2 A G 16: 93,762,054 S563G probably benign Het
Dpp7 C A 2: 25,352,448 G498W probably damaging Het
Fam210a A T 18: 68,275,949 S97T possibly damaging Het
Fastkd1 T A 2: 69,690,157 D767V probably damaging Het
Gimap6 T G 6: 48,708,061 R30S probably benign Het
Gm10840 T C 11: 106,161,133 V95A unknown Het
Herc3 T A 6: 58,876,811 I614N probably damaging Het
Kdr A T 5: 75,936,896 S1233R possibly damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Magi2 A T 5: 20,661,346 K1078N probably damaging Het
Meioc A T 11: 102,679,957 E838V probably damaging Het
Mmp20 A G 9: 7,628,301 K17E probably benign Het
Mtor C T 4: 148,524,500 R1538W probably damaging Het
Notch2 C T 3: 98,098,108 T296I probably damaging Het
Nup98 T C 7: 102,134,964 S1054G probably benign Het
Olfr1463 A C 19: 13,234,852 I201L probably benign Het
Olfr308 T C 7: 86,321,733 Y73C probably damaging Het
Olfr446 T C 6: 42,927,644 C138R probably damaging Het
Olfr455 T C 6: 42,538,600 T141A probably damaging Het
Pipox C A 11: 77,883,175 W205L probably damaging Het
Plin4 T G 17: 56,103,828 T1068P probably benign Het
Pou6f2 A G 13: 18,239,564 S209P unknown Het
Ptpdc1 T C 13: 48,583,156 T713A probably benign Het
Rgsl1 T C 1: 153,825,970 Y246C possibly damaging Het
Rnf19b C T 4: 129,075,653 A354V probably damaging Het
Rsph4a A G 10: 33,909,130 T346A probably benign Het
Rsrc2 T C 5: 123,745,072 T16A unknown Het
Scrn3 T C 2: 73,318,424 V113A possibly damaging Het
Scrn3 T A 2: 73,331,003 I311K possibly damaging Het
Sfmbt1 T C 14: 30,784,191 probably null Het
Sin3a A G 9: 57,095,456 I211V possibly damaging Het
Strn3 T C 12: 51,633,708 T370A probably benign Het
Sulf1 T G 1: 12,848,171 N786K probably damaging Het
Taf1b T A 12: 24,547,119 Y352* probably null Het
Tas2r120 T A 6: 132,657,334 N126K probably benign Het
Tjap1 C A 17: 46,261,506 R68L probably benign Het
Tnfsf12 C T 11: 69,695,404 R66Q probably benign Het
Traj45 A G 14: 54,172,846 D6G Het
Trappc9 T C 15: 72,953,094 T541A probably benign Het
Ttc29 A C 8: 78,325,477 E329A probably benign Het
Vmn1r117 T G 7: 20,883,235 D296A possibly damaging Het
Vmn1r203 A G 13: 22,524,595 N182S probably benign Het
Vps53 C A 11: 76,117,173 R287L probably damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Zfp608 T C 18: 54,946,711 N334S possibly damaging Het
Zfp648 A G 1: 154,204,941 H282R probably damaging Het
Other mutations in Fgg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Fgg APN 3 83014228 missense possibly damaging 0.67
IGL01713:Fgg APN 3 83008416 missense probably benign 0.20
IGL02288:Fgg APN 3 83008153 missense probably benign 0.11
IGL02994:Fgg APN 3 83008474 missense probably benign
R1251:Fgg UTSW 3 83012980 missense probably benign 0.03
R2137:Fgg UTSW 3 83008438 missense possibly damaging 0.78
R2400:Fgg UTSW 3 83008187 missense possibly damaging 0.94
R2436:Fgg UTSW 3 83014189 missense possibly damaging 0.94
R3429:Fgg UTSW 3 83012783 missense probably damaging 1.00
R4356:Fgg UTSW 3 83012943 missense probably damaging 1.00
R4612:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4613:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4828:Fgg UTSW 3 83008370 splice site probably benign
R4898:Fgg UTSW 3 83008540 missense probably benign 0.02
R4938:Fgg UTSW 3 83012868 missense probably benign 0.00
R4967:Fgg UTSW 3 83012765 missense probably benign 0.33
R5635:Fgg UTSW 3 83011423 missense probably benign 0.07
R5740:Fgg UTSW 3 83011525 missense probably benign 0.01
R6307:Fgg UTSW 3 83012976 missense probably damaging 0.98
R6731:Fgg UTSW 3 83012901 missense probably damaging 1.00
R6936:Fgg UTSW 3 83008420 missense possibly damaging 0.82
R7582:Fgg UTSW 3 83014138 missense probably damaging 1.00
R7769:Fgg UTSW 3 83013126 splice site probably null
R8258:Fgg UTSW 3 83010170 nonsense probably null
R8259:Fgg UTSW 3 83010170 nonsense probably null
R8290:Fgg UTSW 3 83012834 missense probably benign 0.00
R8810:Fgg UTSW 3 83013015 missense probably damaging 0.96
R8826:Fgg UTSW 3 83014318 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTATGCCATGTTCAGGGTGG -3'
(R):5'- ATGCCAGTTGGATAATGAGTGG -3'

Sequencing Primer
(F):5'- TGGGTCCCGAGTCTGACAAATAC -3'
(R):5'- CCAGTTGGATAATGAGTGGTATCC -3'
Posted On 2019-06-07