Incidental Mutation 'PIT4519001:Strn3'
ID555132
Institutional Source Beutler Lab
Gene Symbol Strn3
Ensembl Gene ENSMUSG00000020954
Gene Namestriatin, calmodulin binding protein 3
SynonymsSG2NA
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4519001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location51609632-51691897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51633708 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 370 (T370A)
Ref Sequence ENSEMBL: ENSMUSP00000013130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013130] [ENSMUST00000169503]
Predicted Effect probably benign
Transcript: ENSMUST00000013130
AA Change: T370A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000013130
Gene: ENSMUSG00000020954
AA Change: T370A

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 194 1.3e-50 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
WD40 468 507 7.05e-9 SMART
WD40 521 560 2.42e-7 SMART
WD40 574 613 1.62e-8 SMART
WD40 617 659 8.25e0 SMART
WD40 670 708 2.65e1 SMART
WD40 711 750 2.32e-9 SMART
WD40 753 796 4.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169503
SMART Domains Protein: ENSMUSP00000130184
Gene: ENSMUSG00000020954

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 198 3.2e-51 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
WD40 384 423 7.05e-9 SMART
WD40 437 476 2.42e-7 SMART
WD40 490 529 1.62e-8 SMART
WD40 533 575 8.25e0 SMART
WD40 586 624 2.65e1 SMART
WD40 627 666 2.32e-9 SMART
WD40 669 712 4.95e-4 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 84.7%
  • 20x: 70.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,170,666 M803K probably benign Het
4930590J08Rik C A 6: 91,917,057 N218K probably damaging Het
Abcc2 G A 19: 43,819,397 V826M possibly damaging Het
Abcg2 T C 6: 58,674,807 S395P probably damaging Het
Adam1b C T 5: 121,501,947 G345D probably damaging Het
Alx4 T A 2: 93,675,428 C292S probably benign Het
Amd2 C A 10: 35,710,631 C310F possibly damaging Het
BC051665 A T 13: 60,784,175 S137T possibly damaging Het
Bmp1 A G 14: 70,490,029 F705L possibly damaging Het
Coil C T 11: 88,972,726 probably benign Het
Col6a6 G A 9: 105,732,263 P1609S probably benign Het
Cpt1b A T 15: 89,418,863 F633I probably damaging Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Defb4 A G 8: 19,198,736 R2G possibly damaging Het
Dll4 T C 2: 119,332,416 V506A probably benign Het
Dopey2 A G 16: 93,762,054 S563G probably benign Het
Dpp7 C A 2: 25,352,448 G498W probably damaging Het
Fam210a A T 18: 68,275,949 S97T possibly damaging Het
Fastkd1 T A 2: 69,690,157 D767V probably damaging Het
Fgg A T 3: 83,012,939 N342Y probably damaging Het
Gimap6 T G 6: 48,708,061 R30S probably benign Het
Gm10840 T C 11: 106,161,133 V95A unknown Het
Herc3 T A 6: 58,876,811 I614N probably damaging Het
Kdr A T 5: 75,936,896 S1233R possibly damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Magi2 A T 5: 20,661,346 K1078N probably damaging Het
Meioc A T 11: 102,679,957 E838V probably damaging Het
Mmp20 A G 9: 7,628,301 K17E probably benign Het
Mtor C T 4: 148,524,500 R1538W probably damaging Het
Notch2 C T 3: 98,098,108 T296I probably damaging Het
Nup98 T C 7: 102,134,964 S1054G probably benign Het
Olfr1463 A C 19: 13,234,852 I201L probably benign Het
Olfr308 T C 7: 86,321,733 Y73C probably damaging Het
Olfr446 T C 6: 42,927,644 C138R probably damaging Het
Olfr455 T C 6: 42,538,600 T141A probably damaging Het
Pipox C A 11: 77,883,175 W205L probably damaging Het
Plin4 T G 17: 56,103,828 T1068P probably benign Het
Pou6f2 A G 13: 18,239,564 S209P unknown Het
Ptpdc1 T C 13: 48,583,156 T713A probably benign Het
Rgsl1 T C 1: 153,825,970 Y246C possibly damaging Het
Rnf19b C T 4: 129,075,653 A354V probably damaging Het
Rsph4a A G 10: 33,909,130 T346A probably benign Het
Rsrc2 T C 5: 123,745,072 T16A unknown Het
Scrn3 T C 2: 73,318,424 V113A possibly damaging Het
Scrn3 T A 2: 73,331,003 I311K possibly damaging Het
Sfmbt1 T C 14: 30,784,191 probably null Het
Sin3a A G 9: 57,095,456 I211V possibly damaging Het
Sulf1 T G 1: 12,848,171 N786K probably damaging Het
Taf1b T A 12: 24,547,119 Y352* probably null Het
Tas2r120 T A 6: 132,657,334 N126K probably benign Het
Tjap1 C A 17: 46,261,506 R68L probably benign Het
Tnfsf12 C T 11: 69,695,404 R66Q probably benign Het
Traj45 A G 14: 54,172,846 D6G Het
Trappc9 T C 15: 72,953,094 T541A probably benign Het
Ttc29 A C 8: 78,325,477 E329A probably benign Het
Vmn1r117 T G 7: 20,883,235 D296A possibly damaging Het
Vmn1r203 A G 13: 22,524,595 N182S probably benign Het
Vps53 C A 11: 76,117,173 R287L probably damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Zfp608 T C 18: 54,946,711 N334S possibly damaging Het
Zfp648 A G 1: 154,204,941 H282R probably damaging Het
Other mutations in Strn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Strn3 APN 12 51661196 missense possibly damaging 0.63
IGL00690:Strn3 APN 12 51610438 missense possibly damaging 0.96
IGL00886:Strn3 APN 12 51610150 missense probably damaging 1.00
IGL01967:Strn3 APN 12 51652813 missense probably damaging 1.00
IGL02507:Strn3 APN 12 51661627 nonsense probably null
IGL03139:Strn3 APN 12 51652850 splice site probably benign
IGL03282:Strn3 APN 12 51627209 missense probably benign 0.00
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0336:Strn3 UTSW 12 51661608 critical splice donor site probably null
R0492:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0512:Strn3 UTSW 12 51627183 missense possibly damaging 0.94
R0610:Strn3 UTSW 12 51610448 critical splice acceptor site probably null
R0707:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0834:Strn3 UTSW 12 51627096 splice site probably benign
R1562:Strn3 UTSW 12 51633618 missense probably benign
R1599:Strn3 UTSW 12 51652766 missense possibly damaging 0.78
R1663:Strn3 UTSW 12 51652826 missense probably damaging 1.00
R1807:Strn3 UTSW 12 51627203 missense probably benign 0.10
R2263:Strn3 UTSW 12 51643223 splice site probably null
R2443:Strn3 UTSW 12 51627835 missense probably damaging 1.00
R3623:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R3624:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R4154:Strn3 UTSW 12 51627131 missense probably damaging 1.00
R4223:Strn3 UTSW 12 51627855 missense probably damaging 1.00
R4400:Strn3 UTSW 12 51648100 missense possibly damaging 0.85
R4564:Strn3 UTSW 12 51633621 missense probably benign 0.00
R4585:Strn3 UTSW 12 51650170 missense probably benign 0.02
R4755:Strn3 UTSW 12 51610216 missense possibly damaging 0.70
R4794:Strn3 UTSW 12 51650171 missense probably benign 0.38
R5288:Strn3 UTSW 12 51648020 missense probably damaging 1.00
R5308:Strn3 UTSW 12 51629385 missense probably damaging 0.99
R5765:Strn3 UTSW 12 51633627 missense probably benign
R5893:Strn3 UTSW 12 51643223 splice site probably null
R5945:Strn3 UTSW 12 51629496 missense probably benign 0.00
R6244:Strn3 UTSW 12 51610107 missense probably damaging 0.98
R6523:Strn3 UTSW 12 51643098 unclassified probably null
R7437:Strn3 UTSW 12 51610163 missense probably damaging 1.00
R7545:Strn3 UTSW 12 51627760 missense probably damaging 0.98
X0024:Strn3 UTSW 12 51652709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCAATTACACCAAGAGCTC -3'
(R):5'- TTCACTGATCTATCCACAAAGAGCC -3'

Sequencing Primer
(F):5'- CTTCAGCATTTTATACAACAGCATG -3'
(R):5'- TCTATCCACAAAGAGCCACAGAATAG -3'
Posted On2019-06-07