Incidental Mutation 'PIT4519001:Bmp1'
ID 555140
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4519001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70727469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 705 (F705L)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect possibly damaging
Transcript: ENSMUST00000022693
AA Change: F705L

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: F705L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 84.7%
  • 20x: 70.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,217,440 (GRCm39) M803K probably benign Het
4930590J08Rik C A 6: 91,894,038 (GRCm39) N218K probably damaging Het
Abcc2 G A 19: 43,807,836 (GRCm39) V826M possibly damaging Het
Abcg2 T C 6: 58,651,792 (GRCm39) S395P probably damaging Het
Adam1b C T 5: 121,640,010 (GRCm39) G345D probably damaging Het
Alx4 T A 2: 93,505,773 (GRCm39) C292S probably benign Het
Amd2 C A 10: 35,586,627 (GRCm39) C310F possibly damaging Het
BC051665 A T 13: 60,931,989 (GRCm39) S137T possibly damaging Het
Coil C T 11: 88,863,552 (GRCm39) probably benign Het
Col6a6 G A 9: 105,609,462 (GRCm39) P1609S probably benign Het
Cpt1b A T 15: 89,303,066 (GRCm39) F633I probably damaging Het
Dcun1d2 A T 8: 13,311,406 (GRCm39) D194E probably benign Het
Defb4 A G 8: 19,248,752 (GRCm39) R2G possibly damaging Het
Dll4 T C 2: 119,162,897 (GRCm39) V506A probably benign Het
Dop1b A G 16: 93,558,942 (GRCm39) S563G probably benign Het
Dpp7 C A 2: 25,242,460 (GRCm39) G498W probably damaging Het
Fam210a A T 18: 68,409,020 (GRCm39) S97T possibly damaging Het
Fastkd1 T A 2: 69,520,501 (GRCm39) D767V probably damaging Het
Fgg A T 3: 82,920,246 (GRCm39) N342Y probably damaging Het
Gimap6 T G 6: 48,684,995 (GRCm39) R30S probably benign Het
Gm10840 T C 11: 106,051,959 (GRCm39) V95A unknown Het
Herc3 T A 6: 58,853,796 (GRCm39) I614N probably damaging Het
Kdr A T 5: 76,097,556 (GRCm39) S1233R possibly damaging Het
Lrp1 C G 10: 127,443,843 (GRCm39) Q141H possibly damaging Het
Magi2 A T 5: 20,866,344 (GRCm39) K1078N probably damaging Het
Meioc A T 11: 102,570,783 (GRCm39) E838V probably damaging Het
Mmp20 A G 9: 7,628,302 (GRCm39) K17E probably benign Het
Mtor C T 4: 148,608,957 (GRCm39) R1538W probably damaging Het
Notch2 C T 3: 98,005,424 (GRCm39) T296I probably damaging Het
Nup98 T C 7: 101,784,171 (GRCm39) S1054G probably benign Het
Or10ac1 T C 6: 42,515,534 (GRCm39) T141A probably damaging Het
Or2a12 T C 6: 42,904,578 (GRCm39) C138R probably damaging Het
Or5b109 A C 19: 13,212,216 (GRCm39) I201L probably benign Het
Or6f1 T C 7: 85,970,941 (GRCm39) Y73C probably damaging Het
Pipox C A 11: 77,774,001 (GRCm39) W205L probably damaging Het
Plin4 T G 17: 56,410,828 (GRCm39) T1068P probably benign Het
Pou6f2 A G 13: 18,414,149 (GRCm39) S209P unknown Het
Ptpdc1 T C 13: 48,736,632 (GRCm39) T713A probably benign Het
Rgsl1 T C 1: 153,701,716 (GRCm39) Y246C possibly damaging Het
Rnf19b C T 4: 128,969,446 (GRCm39) A354V probably damaging Het
Rsph4a A G 10: 33,785,126 (GRCm39) T346A probably benign Het
Rsrc2 T C 5: 123,883,135 (GRCm39) T16A unknown Het
Scrn3 T C 2: 73,148,768 (GRCm39) V113A possibly damaging Het
Scrn3 T A 2: 73,161,347 (GRCm39) I311K possibly damaging Het
Sfmbt1 T C 14: 30,506,148 (GRCm39) probably null Het
Sin3a A G 9: 57,002,740 (GRCm39) I211V possibly damaging Het
Strn3 T C 12: 51,680,491 (GRCm39) T370A probably benign Het
Sulf1 T G 1: 12,918,395 (GRCm39) N786K probably damaging Het
Taf1b T A 12: 24,597,118 (GRCm39) Y352* probably null Het
Tas2r120 T A 6: 132,634,297 (GRCm39) N126K probably benign Het
Tjap1 C A 17: 46,572,432 (GRCm39) R68L probably benign Het
Tnfsf12 C T 11: 69,586,230 (GRCm39) R66Q probably benign Het
Traj45 A G 14: 54,410,303 (GRCm39) D6G Het
Trappc9 T C 15: 72,824,943 (GRCm39) T541A probably benign Het
Ttc29 A C 8: 79,052,106 (GRCm39) E329A probably benign Het
Vmn1r117 T G 7: 20,617,160 (GRCm39) D296A possibly damaging Het
Vmn1r203 A G 13: 22,708,765 (GRCm39) N182S probably benign Het
Vps53 C A 11: 76,007,999 (GRCm39) R287L probably damaging Het
Vwce G A 19: 10,641,946 (GRCm39) E891K possibly damaging Het
Zfp608 T C 18: 55,079,783 (GRCm39) N334S possibly damaging Het
Zfp648 A G 1: 154,080,687 (GRCm39) H282R probably damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAGGCCTGGCATAACTAAG -3'
(R):5'- TGACACTTTCCCAGGGAGTG -3'

Sequencing Primer
(F):5'- CCTGGCATAACTAAGATTTTAAAGGC -3'
(R):5'- CACTTTCCCAGGGAGTGAGTAGTC -3'
Posted On 2019-06-07