Incidental Mutation 'PIT4519001:Trappc9'
ID555141
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4519001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72953094 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 541 (T541A)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]
Predicted Effect probably benign
Transcript: ENSMUST00000023276
AA Change: T362A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: T362A

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
AA Change: T541A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: T541A

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168191
AA Change: T541A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: T541A

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170633
AA Change: T550A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: T550A

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 84.7%
  • 20x: 70.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,170,666 M803K probably benign Het
4930590J08Rik C A 6: 91,917,057 N218K probably damaging Het
Abcc2 G A 19: 43,819,397 V826M possibly damaging Het
Abcg2 T C 6: 58,674,807 S395P probably damaging Het
Adam1b C T 5: 121,501,947 G345D probably damaging Het
Alx4 T A 2: 93,675,428 C292S probably benign Het
Amd2 C A 10: 35,710,631 C310F possibly damaging Het
BC051665 A T 13: 60,784,175 S137T possibly damaging Het
Bmp1 A G 14: 70,490,029 F705L possibly damaging Het
Coil C T 11: 88,972,726 probably benign Het
Col6a6 G A 9: 105,732,263 P1609S probably benign Het
Cpt1b A T 15: 89,418,863 F633I probably damaging Het
Dcun1d2 A T 8: 13,261,406 D194E probably benign Het
Defb4 A G 8: 19,198,736 R2G possibly damaging Het
Dll4 T C 2: 119,332,416 V506A probably benign Het
Dopey2 A G 16: 93,762,054 S563G probably benign Het
Dpp7 C A 2: 25,352,448 G498W probably damaging Het
Fam210a A T 18: 68,275,949 S97T possibly damaging Het
Fastkd1 T A 2: 69,690,157 D767V probably damaging Het
Fgg A T 3: 83,012,939 N342Y probably damaging Het
Gimap6 T G 6: 48,708,061 R30S probably benign Het
Gm10840 T C 11: 106,161,133 V95A unknown Het
Herc3 T A 6: 58,876,811 I614N probably damaging Het
Kdr A T 5: 75,936,896 S1233R possibly damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Magi2 A T 5: 20,661,346 K1078N probably damaging Het
Meioc A T 11: 102,679,957 E838V probably damaging Het
Mmp20 A G 9: 7,628,301 K17E probably benign Het
Mtor C T 4: 148,524,500 R1538W probably damaging Het
Notch2 C T 3: 98,098,108 T296I probably damaging Het
Nup98 T C 7: 102,134,964 S1054G probably benign Het
Olfr1463 A C 19: 13,234,852 I201L probably benign Het
Olfr308 T C 7: 86,321,733 Y73C probably damaging Het
Olfr446 T C 6: 42,927,644 C138R probably damaging Het
Olfr455 T C 6: 42,538,600 T141A probably damaging Het
Pipox C A 11: 77,883,175 W205L probably damaging Het
Plin4 T G 17: 56,103,828 T1068P probably benign Het
Pou6f2 A G 13: 18,239,564 S209P unknown Het
Ptpdc1 T C 13: 48,583,156 T713A probably benign Het
Rgsl1 T C 1: 153,825,970 Y246C possibly damaging Het
Rnf19b C T 4: 129,075,653 A354V probably damaging Het
Rsph4a A G 10: 33,909,130 T346A probably benign Het
Rsrc2 T C 5: 123,745,072 T16A unknown Het
Scrn3 T C 2: 73,318,424 V113A possibly damaging Het
Scrn3 T A 2: 73,331,003 I311K possibly damaging Het
Sfmbt1 T C 14: 30,784,191 probably null Het
Sin3a A G 9: 57,095,456 I211V possibly damaging Het
Strn3 T C 12: 51,633,708 T370A probably benign Het
Sulf1 T G 1: 12,848,171 N786K probably damaging Het
Taf1b T A 12: 24,547,119 Y352* probably null Het
Tas2r120 T A 6: 132,657,334 N126K probably benign Het
Tjap1 C A 17: 46,261,506 R68L probably benign Het
Tnfsf12 C T 11: 69,695,404 R66Q probably benign Het
Traj45 A G 14: 54,172,846 D6G Het
Ttc29 A C 8: 78,325,477 E329A probably benign Het
Vmn1r117 T G 7: 20,883,235 D296A possibly damaging Het
Vmn1r203 A G 13: 22,524,595 N182S probably benign Het
Vps53 C A 11: 76,117,173 R287L probably damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Zfp608 T C 18: 54,946,711 N334S possibly damaging Het
Zfp648 A G 1: 154,204,941 H282R probably damaging Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- TTTCCAGGAGCGTATAAACACAAG -3'
(R):5'- ACGCCTTTGTGTGGAGAAGG -3'

Sequencing Primer
(F):5'- GGAGCGTATAAACACAAGAACATAC -3'
(R):5'- AGAAGGCTGTATCGAGCCC -3'
Posted On2019-06-07