Incidental Mutation 'PIT4520001:Eif2ak4'
ID555159
Institutional Source Beutler Lab
Gene Symbol Eif2ak4
Ensembl Gene ENSMUSG00000005102
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
SynonymsGCN2
Accession Numbers

MGI: 1353427

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4520001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location118388618-118475234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118462327 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1344 (I1344N)
Ref Sequence ENSEMBL: ENSMUSP00000005233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874]
Predicted Effect probably damaging
Transcript: ENSMUST00000005233
AA Change: I1344N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: I1344N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102527
AA Change: I1232N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: I1232N

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110870
AA Change: I1066N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: I1066N

DomainStartEndE-ValueType
Pfam:Pkinase 45 260 3.3e-22 PFAM
Pfam:Pkinase_Tyr 47 257 1.3e-17 PFAM
Pfam:Pkinase_Tyr 311 385 2.5e-5 PFAM
Pfam:Pkinase 311 386 8e-11 PFAM
low complexity region 450 460 N/A INTRINSIC
Pfam:Pkinase 481 722 1.9e-41 PFAM
Pfam:Pkinase_Tyr 506 720 2.8e-19 PFAM
Pfam:tRNA-synt_His 775 1102 8.7e-19 PFAM
Pfam:HGTP_anticodon2 1114 1369 1.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110872
AA Change: I1223N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: I1223N

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110874
AA Change: I1266N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: I1266N

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)
 

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Eif2ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Eif2ak4 APN 2 118464055 missense probably damaging 1.00
IGL00806:Eif2ak4 APN 2 118441166 missense probably benign 0.08
IGL01343:Eif2ak4 APN 2 118422089 missense probably benign 0.00
IGL01796:Eif2ak4 APN 2 118446304 missense probably benign 0.10
IGL02263:Eif2ak4 APN 2 118461778 missense probably benign 0.00
IGL02391:Eif2ak4 APN 2 118420791 missense probably benign 0.19
IGL02516:Eif2ak4 APN 2 118436254 missense probably damaging 1.00
IGL02603:Eif2ak4 APN 2 118450326 missense probably damaging 1.00
IGL02731:Eif2ak4 APN 2 118388814 missense probably benign
IGL02928:Eif2ak4 APN 2 118472687 critical splice donor site probably null
IGL02947:Eif2ak4 APN 2 118431033 missense probably benign 0.00
IGL03191:Eif2ak4 APN 2 118422212 missense probably damaging 1.00
IGL03202:Eif2ak4 APN 2 118400620 missense probably damaging 1.00
IGL03235:Eif2ak4 APN 2 118443140 missense probably damaging 1.00
IGL03375:Eif2ak4 APN 2 118422318 missense probably benign 0.08
absurdum UTSW 2 118420810 nonsense probably null
Ad UTSW 2 118436241 missense probably damaging 1.00
atchoum UTSW 2 118400653 splice site probably benign
reductio UTSW 2 118436158 splice site probably null
R0023:Eif2ak4 UTSW 2 118462721 missense probably damaging 1.00
R0358:Eif2ak4 UTSW 2 118463929 intron probably null
R0482:Eif2ak4 UTSW 2 118462347 missense probably damaging 1.00
R0505:Eif2ak4 UTSW 2 118431036 missense probably benign 0.01
R0523:Eif2ak4 UTSW 2 118442096 critical splice donor site probably null
R0578:Eif2ak4 UTSW 2 118474991 splice site probably benign
R0615:Eif2ak4 UTSW 2 118436185 missense probably damaging 1.00
R1300:Eif2ak4 UTSW 2 118463983 missense possibly damaging 0.79
R1531:Eif2ak4 UTSW 2 118443210 missense probably damaging 1.00
R1777:Eif2ak4 UTSW 2 118430839 missense probably damaging 0.98
R1866:Eif2ak4 UTSW 2 118472661 missense probably damaging 1.00
R1932:Eif2ak4 UTSW 2 118448486 missense probably damaging 1.00
R1977:Eif2ak4 UTSW 2 118461757 nonsense probably null
R2011:Eif2ak4 UTSW 2 118430947 missense probably damaging 1.00
R2046:Eif2ak4 UTSW 2 118451408 splice site probably benign
R2122:Eif2ak4 UTSW 2 118455793 missense probably damaging 1.00
R2125:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2126:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2193:Eif2ak4 UTSW 2 118422266 missense probably benign 0.12
R2259:Eif2ak4 UTSW 2 118455783 missense probably damaging 0.97
R2513:Eif2ak4 UTSW 2 118426583 missense probably damaging 1.00
R3798:Eif2ak4 UTSW 2 118474083 missense probably damaging 1.00
R3898:Eif2ak4 UTSW 2 118430923 missense probably damaging 1.00
R3900:Eif2ak4 UTSW 2 118475029 missense probably damaging 1.00
R4375:Eif2ak4 UTSW 2 118427924 missense probably damaging 1.00
R4423:Eif2ak4 UTSW 2 118439066 missense probably benign 0.01
R4589:Eif2ak4 UTSW 2 118417338 missense probably damaging 1.00
R4734:Eif2ak4 UTSW 2 118422087 missense probably damaging 1.00
R5173:Eif2ak4 UTSW 2 118408360 missense probably damaging 1.00
R5367:Eif2ak4 UTSW 2 118436158 splice site probably null
R5471:Eif2ak4 UTSW 2 118474132 missense probably benign 0.02
R5528:Eif2ak4 UTSW 2 118427938 missense probably damaging 1.00
R5634:Eif2ak4 UTSW 2 118462311 missense probably damaging 1.00
R5726:Eif2ak4 UTSW 2 118443132 missense probably damaging 1.00
R5756:Eif2ak4 UTSW 2 118462740 missense possibly damaging 0.95
R5779:Eif2ak4 UTSW 2 118412963 missense possibly damaging 0.85
R5807:Eif2ak4 UTSW 2 118388851 missense probably benign
R6045:Eif2ak4 UTSW 2 118388815 nonsense probably null
R6187:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R6193:Eif2ak4 UTSW 2 118400600 start gained probably benign
R6468:Eif2ak4 UTSW 2 118436241 missense probably damaging 1.00
R6555:Eif2ak4 UTSW 2 118427869 missense probably damaging 0.96
R6616:Eif2ak4 UTSW 2 118454845 nonsense probably null
R6737:Eif2ak4 UTSW 2 118462268 frame shift probably null
R6956:Eif2ak4 UTSW 2 118422267 missense probably damaging 0.96
R7075:Eif2ak4 UTSW 2 118420810 nonsense probably null
R7109:Eif2ak4 UTSW 2 118405051 missense probably damaging 1.00
R7228:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R7441:Eif2ak4 UTSW 2 118471896 missense probably benign 0.01
R7555:Eif2ak4 UTSW 2 118417283 missense possibly damaging 0.64
R7567:Eif2ak4 UTSW 2 118450314 missense probably benign
X0061:Eif2ak4 UTSW 2 118468176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTGTAGTCCACATTCCAC -3'
(R):5'- GGAATCTGTGGATAGACCGG -3'

Sequencing Primer
(F):5'- TGTAGTCCACATTCCACAGCTGAG -3'
(R):5'- CGTGGTACATGCCTGTAATCTCAG -3'
Posted On2019-06-07