Incidental Mutation 'PIT4520001:Mfn1'
ID555162
Institutional Source Beutler Lab
Gene Symbol Mfn1
Ensembl Gene ENSMUSG00000027668
Gene Namemitofusin 1
Synonyms6330416C07Rik, HR2, D3Ertd265e, 2310002F04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4520001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32529465-32579239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32561546 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 353 (N353D)
Ref Sequence ENSEMBL: ENSMUSP00000088801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091257] [ENSMUST00000118286] [ENSMUST00000151320]
PDB Structure
Mitofusin domain HR2 V686M/I708M mutant [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000091257
AA Change: N353D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088801
Gene: ENSMUSG00000027668
AA Change: N353D

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.7e-6 PFAM
Pfam:Dynamin_N 78 238 3.9e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 575 735 1.2e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118286
AA Change: N353D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113251
Gene: ENSMUSG00000027668
AA Change: N353D

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.2e-6 PFAM
Pfam:Dynamin_N 78 238 5e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 567 737 6.3e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151320
AA Change: N1D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120960
Gene: ENSMUSG00000027668
AA Change: N1D

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Fzo_mitofusin 215 319 1.2e-56 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mediator of mitochondrial fusion. This protein and mitofusin 2 are homologs of the Drosophila protein fuzzy onion (Fzo). They are mitochondrial membrane proteins that interact with each other to facilitate mitochondrial targeting. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Mfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Mfn1 APN 3 32542836 missense probably damaging 1.00
IGL01687:Mfn1 APN 3 32563366 splice site probably benign
IGL02743:Mfn1 APN 3 32574290 missense probably benign 0.10
R0039:Mfn1 UTSW 3 32538267 splice site probably benign
R0571:Mfn1 UTSW 3 32561472 missense probably damaging 1.00
R0920:Mfn1 UTSW 3 32534236 critical splice acceptor site probably null
R1661:Mfn1 UTSW 3 32534322 missense probably benign 0.00
R1665:Mfn1 UTSW 3 32534322 missense probably benign 0.00
R2153:Mfn1 UTSW 3 32542826 missense probably damaging 1.00
R2156:Mfn1 UTSW 3 32534251 missense possibly damaging 0.60
R2260:Mfn1 UTSW 3 32563426 nonsense probably null
R2420:Mfn1 UTSW 3 32569515 missense probably benign 0.21
R3864:Mfn1 UTSW 3 32563092 missense possibly damaging 0.89
R4079:Mfn1 UTSW 3 32542849 missense probably damaging 1.00
R4162:Mfn1 UTSW 3 32562998 splice site probably benign
R4897:Mfn1 UTSW 3 32546562 intron probably benign
R5115:Mfn1 UTSW 3 32564307 critical splice donor site probably null
R5276:Mfn1 UTSW 3 32564205 missense probably benign 0.39
R5590:Mfn1 UTSW 3 32563847 missense probably benign 0.00
R5629:Mfn1 UTSW 3 32561510 missense possibly damaging 0.83
R6110:Mfn1 UTSW 3 32563024 missense probably benign 0.01
R6114:Mfn1 UTSW 3 32563836 missense probably damaging 1.00
R6560:Mfn1 UTSW 3 32569516 missense probably damaging 0.96
R6891:Mfn1 UTSW 3 32577103 missense possibly damaging 0.49
R7053:Mfn1 UTSW 3 32531965 missense probably benign 0.00
R7071:Mfn1 UTSW 3 32568395 missense probably benign 0.00
R7182:Mfn1 UTSW 3 32564220 missense probably damaging 1.00
R8190:Mfn1 UTSW 3 32568389 missense possibly damaging 0.88
Z1177:Mfn1 UTSW 3 32564291 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTTGCTGCTTAGCGCTTC -3'
(R):5'- AGGTCACACCATCTTCCAATG -3'

Sequencing Primer
(F):5'- GCTGCTTAGCGCTTCCTTTGTAG -3'
(R):5'- TAAAGCACCCCTGTAGCA -3'
Posted On2019-06-07