Incidental Mutation 'PIT4520001:Catsperg2'
ID555178
Institutional Source Beutler Lab
Gene Symbol Catsperg2
Ensembl Gene ENSMUSG00000049123
Gene Namecation channel sperm associated auxiliary subunit gamma 2
Synonyms1700067C01Rik, CATSPERG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #PIT4520001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29697219-29727032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29710161 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 536 (Y536H)
Ref Sequence ENSEMBL: ENSMUSP00000147099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061193
AA Change: Y536H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: Y536H

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207115
Predicted Effect probably benign
Transcript: ENSMUST00000208371
Predicted Effect possibly damaging
Transcript: ENSMUST00000208607
AA Change: Y536H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209126
AA Change: Y536H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Catsperg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Catsperg2 APN 7 29705404 missense possibly damaging 0.86
IGL00095:Catsperg2 APN 7 29698058 missense possibly damaging 0.73
IGL00902:Catsperg2 APN 7 29701143 missense possibly damaging 0.93
IGL01667:Catsperg2 APN 7 29710133 missense probably damaging 0.98
IGL01791:Catsperg2 APN 7 29704665 splice site probably null
IGL01961:Catsperg2 APN 7 29721672 splice site probably benign
IGL02187:Catsperg2 APN 7 29721366 missense probably benign 0.02
IGL02605:Catsperg2 APN 7 29719565 missense possibly damaging 0.71
IGL03001:Catsperg2 APN 7 29725079 missense probably benign 0.32
IGL03228:Catsperg2 APN 7 29698225 missense probably damaging 0.96
IGL03239:Catsperg2 APN 7 29697716 missense probably benign 0.04
IGL03242:Catsperg2 APN 7 29725479 unclassified probably benign
IGL03247:Catsperg2 APN 7 29717048 missense possibly damaging 0.71
IGL03256:Catsperg2 APN 7 29709874 missense probably damaging 0.99
R0052:Catsperg2 UTSW 7 29725020 splice site probably benign
R0281:Catsperg2 UTSW 7 29706571 missense possibly damaging 0.86
R0357:Catsperg2 UTSW 7 29714901 missense possibly damaging 0.93
R0480:Catsperg2 UTSW 7 29721298 missense probably damaging 0.98
R0578:Catsperg2 UTSW 7 29704691 missense possibly damaging 0.71
R0732:Catsperg2 UTSW 7 29700696 missense probably damaging 1.00
R0826:Catsperg2 UTSW 7 29705624 missense possibly damaging 0.92
R1535:Catsperg2 UTSW 7 29698246 missense possibly damaging 0.85
R1925:Catsperg2 UTSW 7 29697764 missense probably benign 0.01
R1990:Catsperg2 UTSW 7 29721045 nonsense probably null
R3433:Catsperg2 UTSW 7 29701218 missense possibly damaging 0.71
R3721:Catsperg2 UTSW 7 29705102 missense probably benign 0.02
R4020:Catsperg2 UTSW 7 29717004 missense probably damaging 0.99
R4760:Catsperg2 UTSW 7 29705635 missense probably damaging 0.99
R4829:Catsperg2 UTSW 7 29701125 missense probably damaging 0.98
R5033:Catsperg2 UTSW 7 29710134 missense possibly damaging 0.93
R5093:Catsperg2 UTSW 7 29716998 missense probably benign 0.32
R5266:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5267:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5287:Catsperg2 UTSW 7 29697838 missense possibly damaging 0.96
R5427:Catsperg2 UTSW 7 29714850 missense possibly damaging 0.71
R5575:Catsperg2 UTSW 7 29705590 missense possibly damaging 0.84
R5685:Catsperg2 UTSW 7 29701188 missense probably damaging 1.00
R5844:Catsperg2 UTSW 7 29697832 missense possibly damaging 0.96
R5982:Catsperg2 UTSW 7 29713017 missense possibly damaging 0.51
R6662:Catsperg2 UTSW 7 29719513 start gained probably benign
R6744:Catsperg2 UTSW 7 29709819 missense probably benign 0.23
R7171:Catsperg2 UTSW 7 29705325 missense possibly damaging 0.71
R7239:Catsperg2 UTSW 7 29710082 missense probably benign 0.00
R7336:Catsperg2 UTSW 7 29706601 missense possibly damaging 0.83
R7498:Catsperg2 UTSW 7 29717102 missense possibly damaging 0.71
R7548:Catsperg2 UTSW 7 29709826 missense probably benign 0.32
R7562:Catsperg2 UTSW 7 29697719 missense probably benign 0.18
R7565:Catsperg2 UTSW 7 29712981 missense probably null 0.71
R7600:Catsperg2 UTSW 7 29704858 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGGAAACCTCCTTGTAGCTCC -3'
(R):5'- TTCAGGGACCCCAAAATAAAGG -3'

Sequencing Primer
(F):5'- GTAGCTCCCAACCTGCTC -3'
(R):5'- GTCAGTAGAAGGCGCTACC -3'
Posted On2019-06-07