Incidental Mutation 'PIT4520001:Olfr574'
ID555179
Institutional Source Beutler Lab
Gene Symbol Olfr574
Ensembl Gene ENSMUSG00000045824
Gene Nameolfactory receptor 574
SynonymsGA_x6K02T2PBJ9-5659738-5660748, MOR14-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #PIT4520001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102948467-102949507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102948714 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 83 (D83V)
Ref Sequence ENSEMBL: ENSMUSP00000095815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052997] [ENSMUST00000211329] [ENSMUST00000213477] [ENSMUST00000216420]
Predicted Effect probably damaging
Transcript: ENSMUST00000052997
AA Change: D83V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095815
Gene: ENSMUSG00000045824
AA Change: D83V

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:7tm_4 44 323 3.8e-96 PFAM
Pfam:7TM_GPCR_Srsx 48 195 1.2e-8 PFAM
Pfam:7tm_1 54 305 2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211329
AA Change: D73V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213477
Predicted Effect probably benign
Transcript: ENSMUST00000216420
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Olfr574
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Olfr574 APN 7 102948839 missense probably damaging 1.00
IGL01732:Olfr574 APN 7 102949239 missense probably damaging 1.00
IGL02185:Olfr574 APN 7 102948514 missense probably damaging 0.96
PIT4382001:Olfr574 UTSW 7 102949449 missense probably benign
R0765:Olfr574 UTSW 7 102948732 missense probably damaging 1.00
R1616:Olfr574 UTSW 7 102948514 missense probably damaging 0.96
R2041:Olfr574 UTSW 7 102948963 missense probably damaging 0.98
R2079:Olfr574 UTSW 7 102949495 missense probably benign 0.00
R2261:Olfr574 UTSW 7 102949257 missense probably damaging 1.00
R2263:Olfr574 UTSW 7 102949257 missense probably damaging 1.00
R2513:Olfr574 UTSW 7 102949493 missense probably benign
R2903:Olfr574 UTSW 7 102949454 missense probably benign 0.05
R4445:Olfr574 UTSW 7 102948798 missense possibly damaging 0.93
R4512:Olfr574 UTSW 7 102948738 missense probably damaging 1.00
R4513:Olfr574 UTSW 7 102948738 missense probably damaging 1.00
R4528:Olfr574 UTSW 7 102948806 missense probably damaging 1.00
R4904:Olfr574 UTSW 7 102949065 missense probably damaging 1.00
R5935:Olfr574 UTSW 7 102948810 missense probably benign 0.01
R6784:Olfr574 UTSW 7 102948515 missense possibly damaging 0.91
R6889:Olfr574 UTSW 7 102948768 missense possibly damaging 0.94
R7082:Olfr574 UTSW 7 102949248 missense probably damaging 1.00
R7125:Olfr574 UTSW 7 102949179 missense probably damaging 0.99
R7549:Olfr574 UTSW 7 102948591 missense possibly damaging 0.92
R7564:Olfr574 UTSW 7 102949266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTCAAGTCACCATGCTGATC -3'
(R):5'- ACTTCAGAGGGCTGCAGATG -3'

Sequencing Primer
(F):5'- TGCTGATCTTCAATAATACCACATCC -3'
(R):5'- CTGCAGATGGCCAAGTAGC -3'
Posted On2019-06-07