Incidental Mutation 'R0602:Olfr1505'
ID55519
Institutional Source Beutler Lab
Gene Symbol Olfr1505
Ensembl Gene ENSMUSG00000062314
Gene Nameolfactory receptor 1505
SynonymsMOR211-4P, GA_x6K02T2RE5P-4250267-4251217, MOR211-10_i
MMRRC Submission 038791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0602 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13913530-13921866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13919781 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 254 (T254A)
Ref Sequence ENSEMBL: ENSMUSP00000148945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081520] [ENSMUST00000216623] [ENSMUST00000216835]
Predicted Effect probably benign
Transcript: ENSMUST00000081520
AA Change: T254A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080235
Gene: ENSMUSG00000062314
AA Change: T254A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-43 PFAM
Pfam:7tm_1 41 290 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216623
AA Change: T254A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216835
AA Change: T254A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.7%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik T C 7: 137,376,361 probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Arih1 A G 9: 59,394,871 probably benign Het
Bcl9 T C 3: 97,205,786 I1118V probably benign Het
Cap1 T C 4: 122,872,409 E12G probably damaging Het
Ccr2 A G 9: 124,106,621 I313V probably benign Het
Cd1d2 T C 3: 86,987,803 S161P probably benign Het
Cd226 C T 18: 89,269,011 T311I probably benign Het
Col25a1 A G 3: 130,575,414 probably null Het
Cspg4 T C 9: 56,888,017 F1012S probably damaging Het
Dnah7b A G 1: 46,324,842 M3541V probably damaging Het
Erbb2 G A 11: 98,434,271 V852M probably damaging Het
Fer1l6 A C 15: 58,577,945 T667P probably damaging Het
Gal3st2c A G 1: 94,009,179 Y282C probably damaging Het
Glp1r T C 17: 30,909,227 L60P probably benign Het
Gm8251 T A 1: 44,059,967 K657I possibly damaging Het
Gtf2h2 A G 13: 100,469,025 V358A probably benign Het
Hephl1 T A 9: 15,089,051 I302F probably damaging Het
Hist2h2aa1 T C 3: 96,245,550 probably benign Het
Lgi2 T C 5: 52,554,423 D185G probably damaging Het
Lrtm1 T C 14: 29,022,222 probably benign Het
Megf10 T G 18: 57,262,100 D511E probably damaging Het
Myo5c A G 9: 75,266,196 probably null Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Ola1 A G 2: 73,093,712 Y368H probably damaging Het
Olfr1497 T C 19: 13,794,662 probably null Het
Olfr593 A C 7: 103,212,580 H229P possibly damaging Het
Panx1 A G 9: 15,010,204 L125P probably damaging Het
Pappa2 A G 1: 158,763,055 probably benign Het
Parp6 A G 9: 59,649,365 probably benign Het
Pomgnt2 A G 9: 121,982,273 Y481H probably benign Het
Ppp4c A G 7: 126,789,082 probably benign Het
Prl8a8 T A 13: 27,508,550 probably benign Het
Prpf40b C A 15: 99,304,471 A70E unknown Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Ptprc C T 1: 138,089,485 probably benign Het
Rgs22 T C 15: 36,139,872 probably benign Het
Rpgrip1 A G 14: 52,133,856 E344G possibly damaging Het
Sgca A T 11: 94,963,235 I383N possibly damaging Het
Sgms2 T A 3: 131,325,107 probably null Het
Slc9b1 C A 3: 135,397,755 Q549K probably benign Het
Smc4 G C 3: 69,009,538 A187P probably damaging Het
Smco1 A G 16: 32,273,244 S47G probably damaging Het
Sobp T A 10: 43,022,389 E400V probably damaging Het
Stil T A 4: 115,024,423 probably benign Het
Sult3a2 A T 10: 33,782,048 M23K probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcof1 C A 18: 60,833,533 G329W probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Vmn1r171 G T 7: 23,633,177 V276L probably benign Het
Vps13b T C 15: 35,422,368 L158P probably damaging Het
Vps54 A G 11: 21,306,434 I634M possibly damaging Het
Vwa8 T G 14: 79,020,620 S736R probably benign Het
Other mutations in Olfr1505
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr1505 APN 19 13919528 nonsense probably null
IGL03388:Olfr1505 APN 19 13919620 missense probably damaging 0.99
R0143:Olfr1505 UTSW 19 13919250 missense probably damaging 1.00
R0326:Olfr1505 UTSW 19 13919509 missense probably benign 0.13
R0624:Olfr1505 UTSW 19 13919444 missense probably damaging 0.99
R0947:Olfr1505 UTSW 19 13919171 missense probably benign 0.00
R1472:Olfr1505 UTSW 19 13919844 missense probably damaging 1.00
R1691:Olfr1505 UTSW 19 13919419 missense probably benign 0.00
R2991:Olfr1505 UTSW 19 13919311 missense probably damaging 1.00
R4296:Olfr1505 UTSW 19 13919353 missense probably damaging 1.00
R4688:Olfr1505 UTSW 19 13919241 missense probably benign 0.01
R4814:Olfr1505 UTSW 19 13919453 missense possibly damaging 0.50
R4823:Olfr1505 UTSW 19 13919658 missense probably benign 0.02
R5038:Olfr1505 UTSW 19 13919458 missense possibly damaging 0.58
R5243:Olfr1505 UTSW 19 13919661 missense probably damaging 1.00
R5323:Olfr1505 UTSW 19 13919616 missense possibly damaging 0.95
R5542:Olfr1505 UTSW 19 13919047 missense probably benign 0.04
R5918:Olfr1505 UTSW 19 13919775 missense probably damaging 1.00
R6011:Olfr1505 UTSW 19 13919157 missense probably benign 0.00
R6159:Olfr1505 UTSW 19 13919740 missense probably damaging 1.00
R7535:Olfr1505 UTSW 19 13919085 missense probably benign
R8262:Olfr1505 UTSW 19 13919862 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCTATGGACGTTGTGCTGCC -3'
(R):5'- ACCAGTAACCTTCTTGAATGCAGCC -3'

Sequencing Primer
(F):5'- GTGCAGCTACAGAATGTTTCC -3'
(R):5'- GAATGCAGCCTTGACATCCTTG -3'
Posted On2013-07-11