Incidental Mutation 'PIT4520001:St6galnac1'
ID555191
Institutional Source Beutler Lab
Gene Symbol St6galnac1
Ensembl Gene ENSMUSG00000009588
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
SynonymsSiat7a, ST6GalNAc I
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #PIT4520001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location116765025-116775507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116769349 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 46 (N46S)
Ref Sequence ENSEMBL: ENSMUSP00000009732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009732]
Predicted Effect probably benign
Transcript: ENSMUST00000009732
AA Change: N46S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000009732
Gene: ENSMUSG00000009588
AA Change: N46S

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 230 518 2.9e-72 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of proteins affects cell-cell interaction, interactions with the matrix, and the functions of intracellular molecules. ST6GALNAC1 transfers a sialic acid, N-acetylneuraminic acid (NeuAc), in an alpha-2,6 linkage to O-linked GalNAc residues. The cancer-associated sialyl-Tn (sTn) antigen is formed by ST6GALNAC1-catalyzed sialylation of GalNAc residues on mucins (Ikehara et al., 1999 [PubMed 10536037]; Sewell et al., 2006 [PubMed 16319059]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in St6galnac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:St6galnac1 APN 11 116767706 missense probably damaging 1.00
IGL01451:St6galnac1 APN 11 116769339 missense probably benign 0.00
IGL01873:St6galnac1 APN 11 116766611 missense probably damaging 0.98
IGL02569:St6galnac1 APN 11 116767702 missense probably damaging 1.00
IGL02799:St6galnac1 APN 11 116766647 splice site probably benign
IGL02935:St6galnac1 APN 11 116769345 missense probably benign
IGL03124:St6galnac1 APN 11 116775299 missense probably benign 0.00
R0126:St6galnac1 UTSW 11 116766584 missense probably benign 0.00
R0363:St6galnac1 UTSW 11 116768930 missense probably benign 0.36
R0394:St6galnac1 UTSW 11 116766640 missense probably damaging 0.99
R0828:St6galnac1 UTSW 11 116768997 missense probably benign 0.05
R1569:St6galnac1 UTSW 11 116769271 missense possibly damaging 0.46
R1570:St6galnac1 UTSW 11 116766648 splice site probably benign
R1591:St6galnac1 UTSW 11 116765863 missense probably damaging 1.00
R1602:St6galnac1 UTSW 11 116769287 missense probably benign 0.00
R2088:St6galnac1 UTSW 11 116769107 missense probably benign 0.00
R2212:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R2266:St6galnac1 UTSW 11 116767847 nonsense probably null
R3413:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R3835:St6galnac1 UTSW 11 116766283 missense probably damaging 1.00
R5016:St6galnac1 UTSW 11 116765880 missense probably damaging 1.00
R5446:St6galnac1 UTSW 11 116766269 missense probably benign 0.37
R6625:St6galnac1 UTSW 11 116765891 missense probably damaging 1.00
R6805:St6galnac1 UTSW 11 116768944 missense probably damaging 1.00
R7007:St6galnac1 UTSW 11 116767007 nonsense probably null
R7133:St6galnac1 UTSW 11 116767073 missense possibly damaging 0.89
R7491:St6galnac1 UTSW 11 116769184 missense probably benign 0.14
R7724:St6galnac1 UTSW 11 116766072 critical splice donor site probably null
R7812:St6galnac1 UTSW 11 116769101 missense probably benign 0.16
R8160:St6galnac1 UTSW 11 116775490 start gained probably benign
Z1177:St6galnac1 UTSW 11 116775428 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTGGCCTTATGGTCTCCAAC -3'
(R):5'- TGGGCTTGCAGATACTTGCC -3'

Sequencing Primer
(F):5'- GGCCTTATGGTCTCCAACTTCCTC -3'
(R):5'- GCAGATACTTGCCTGGCTG -3'
Posted On2019-06-07