Incidental Mutation 'PIT4520001:Ankmy2'
ID555194
Institutional Source Beutler Lab
Gene Symbol Ankmy2
Ensembl Gene ENSMUSG00000036188
Gene Nameankyrin repeat and MYND domain containing 2
Synonyms
Accession Numbers

Genbank: NM_146033; MGI: 2144755

Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #PIT4520001 (G1)
Quality Score197.009
Status Not validated
Chromosome12
Chromosomal Location36157114-36197291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36157391 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 12 (E12G)
Ref Sequence ENSEMBL: ENSMUSP00000039484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020856] [ENSMUST00000041640] [ENSMUST00000220763] [ENSMUST00000220828] [ENSMUST00000221388] [ENSMUST00000223382] [ENSMUST00000223474]
Predicted Effect probably benign
Transcript: ENSMUST00000020856
SMART Domains Protein: ENSMUSP00000020856
Gene: ENSMUSG00000020547

DomainStartEndE-ValueType
eIF5C 326 411 3.29e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041640
AA Change: E12G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039484
Gene: ENSMUSG00000036188
AA Change: E12G

DomainStartEndE-ValueType
ANK 45 74 1.1e-6 SMART
ANK 79 108 7.83e-3 SMART
ANK 112 143 9.33e2 SMART
Pfam:zf-MYND 320 357 6.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220763
Predicted Effect probably benign
Transcript: ENSMUST00000220828
Predicted Effect probably benign
Transcript: ENSMUST00000221388
Predicted Effect probably benign
Transcript: ENSMUST00000223382
Predicted Effect probably benign
Transcript: ENSMUST00000223474
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Ankmy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01971:Ankmy2 APN 12 36193793 nonsense probably null
IGL02588:Ankmy2 APN 12 36176686 splice site probably benign
IGL02975:Ankmy2 APN 12 36193774 missense possibly damaging 0.50
IGL03076:Ankmy2 APN 12 36165918 missense probably damaging 0.98
7510:Ankmy2 UTSW 12 36157412 missense probably benign 0.06
R0135:Ankmy2 UTSW 12 36170435 splice site probably benign
R0319:Ankmy2 UTSW 12 36165899 missense possibly damaging 0.76
R0347:Ankmy2 UTSW 12 36193754 missense probably damaging 1.00
R0485:Ankmy2 UTSW 12 36182390 missense possibly damaging 0.94
R0557:Ankmy2 UTSW 12 36187766 missense probably benign 0.38
R1304:Ankmy2 UTSW 12 36186805 missense probably damaging 0.99
R1397:Ankmy2 UTSW 12 36170441 splice site probably benign
R1572:Ankmy2 UTSW 12 36186942 critical splice donor site probably null
R1674:Ankmy2 UTSW 12 36187669 missense probably benign
R1874:Ankmy2 UTSW 12 36165931 missense possibly damaging 0.77
R1887:Ankmy2 UTSW 12 36170468 missense possibly damaging 0.71
R1985:Ankmy2 UTSW 12 36157364 missense possibly damaging 0.86
R1996:Ankmy2 UTSW 12 36193797 missense probably benign 0.00
R4964:Ankmy2 UTSW 12 36186918 missense possibly damaging 0.69
R5534:Ankmy2 UTSW 12 36182492 missense probably damaging 0.96
R5606:Ankmy2 UTSW 12 36165921 missense probably benign 0.19
R5614:Ankmy2 UTSW 12 36193784 missense probably damaging 1.00
R5906:Ankmy2 UTSW 12 36176633 missense probably damaging 1.00
R6427:Ankmy2 UTSW 12 36187711 missense possibly damaging 0.49
R7065:Ankmy2 UTSW 12 36187708 missense probably damaging 0.96
R7135:Ankmy2 UTSW 12 36196312 missense probably benign
R7705:Ankmy2 UTSW 12 36195108 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TAGCGACTCTGCCACTTCAC -3'
(R):5'- TAGAGGTCTAAGCTCGGCAACC -3'

Sequencing Primer
(F):5'- TGCCACTTCACTGGGCTG -3'
(R):5'- TAAGCTCGGCAACCTAGATCTGATG -3'
Posted On2019-06-07