Incidental Mutation 'R0603:Pkhd1'
ID 55520
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Name polycystic kidney and hepatic disease 1
Synonyms FPC, tigmin
MMRRC Submission 038792-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R0603 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 20128003-20688288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20187397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 3637 (M3637K)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000088448
AA Change: M3637K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: M3637K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc7 A G 5: 122,578,233 (GRCm39) N406S probably benign Het
Arhgap4 C T X: 72,950,389 (GRCm39) R54Q probably damaging Het
Asb15 T A 6: 24,556,556 (GRCm39) I17N probably damaging Het
Atp8a1 T C 5: 67,914,039 (GRCm39) probably null Het
Caprin1 A G 2: 103,627,146 (GRCm39) V47A probably benign Het
Col4a2 T C 8: 11,464,779 (GRCm39) V348A probably benign Het
Disp2 A G 2: 118,622,487 (GRCm39) K1073R probably damaging Het
Dmxl2 G A 9: 54,313,190 (GRCm39) H1686Y possibly damaging Het
Dzank1 C T 2: 144,353,432 (GRCm39) V152I probably benign Het
Elp1 A T 4: 56,792,105 (GRCm39) I221N possibly damaging Het
Evl T A 12: 108,614,681 (GRCm39) I25N probably damaging Het
Fam117a A G 11: 95,271,699 (GRCm39) K424E probably damaging Het
Gm17732 C T 18: 62,795,823 (GRCm39) probably benign Het
Gpr158 T C 2: 21,820,480 (GRCm39) I659T possibly damaging Het
Hectd4 T A 5: 121,442,400 (GRCm39) V1280E possibly damaging Het
Irs4 T C X: 140,508,071 (GRCm39) T42A probably damaging Het
Kdm4a C T 4: 117,999,708 (GRCm39) V905I probably damaging Het
Lmtk3 T A 7: 45,444,980 (GRCm39) probably benign Het
Lsp1 G A 7: 142,043,115 (GRCm39) R221H probably damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mmut A T 17: 41,258,057 (GRCm39) I408F probably damaging Het
Nckap1 A T 2: 80,343,073 (GRCm39) V942E probably benign Het
Neto1 T A 18: 86,491,785 (GRCm39) C229S possibly damaging Het
Nipal2 A G 15: 34,650,544 (GRCm39) I63T probably damaging Het
Or11g2 T C 14: 50,855,967 (GRCm39) I96T probably damaging Het
Or1af1 G A 2: 37,110,118 (GRCm39) V206I probably damaging Het
Or4k49 A T 2: 111,495,225 (GRCm39) Y218F probably damaging Het
Or7e165 A T 9: 19,695,235 (GRCm39) R269W probably damaging Het
Or8g36 C A 9: 39,422,810 (GRCm39) V69F possibly damaging Het
Pgpep1 T C 8: 71,103,283 (GRCm39) E120G probably benign Het
Pkm T C 9: 59,573,164 (GRCm39) V58A probably damaging Het
Ppp2r1b C A 9: 50,772,985 (GRCm39) T154K probably damaging Het
Rgs18 T A 1: 144,631,818 (GRCm39) D98V possibly damaging Het
Rsph6a G T 7: 18,799,886 (GRCm39) A506S possibly damaging Het
Selenop T A 15: 3,305,183 (GRCm39) V113E probably damaging Het
Slc6a11 G A 6: 114,221,851 (GRCm39) V514M probably benign Het
Srsf9 C T 5: 115,470,696 (GRCm39) S132L probably damaging Het
Tchh G A 3: 93,351,088 (GRCm39) R176H possibly damaging Het
Tcp11 T C 17: 28,286,784 (GRCm39) N405S probably damaging Het
Tle1 A C 4: 72,036,584 (GRCm39) D760E probably damaging Het
Tmem178 A G 17: 81,252,488 (GRCm39) D124G possibly damaging Het
Trabd G A 15: 88,966,929 (GRCm39) E118K probably damaging Het
Ttc39a A G 4: 109,283,499 (GRCm39) D115G probably damaging Het
Uaca T A 9: 60,778,379 (GRCm39) M920K possibly damaging Het
Uba2 A T 7: 33,861,038 (GRCm39) M5K probably damaging Het
Unc5c C T 3: 141,476,863 (GRCm39) P343L probably damaging Het
Wdhd1 T C 14: 47,501,043 (GRCm39) D453G probably damaging Het
Wfdc8 A G 2: 164,445,145 (GRCm39) Y157H probably damaging Het
Zbbx T G 3: 74,985,757 (GRCm39) K432Q probably benign Het
Zeb2 G A 2: 44,907,438 (GRCm39) T169M probably benign Het
Zfp956 A G 6: 47,932,962 (GRCm39) E79G probably damaging Het
Zzef1 G A 11: 72,708,895 (GRCm39) V165I probably benign Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20,637,098 (GRCm39) critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20,594,294 (GRCm39) missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20,151,408 (GRCm39) critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20,641,614 (GRCm39) missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20,187,971 (GRCm39) missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20,593,482 (GRCm39) missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20,279,400 (GRCm39) missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20,604,754 (GRCm39) splice site probably benign
IGL01313:Pkhd1 APN 1 20,271,248 (GRCm39) missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20,593,201 (GRCm39) missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20,619,939 (GRCm39) missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20,269,683 (GRCm39) missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20,629,643 (GRCm39) critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20,187,203 (GRCm39) missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20,604,857 (GRCm39) nonsense probably null
IGL01790:Pkhd1 APN 1 20,628,895 (GRCm39) missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20,429,134 (GRCm39) missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20,173,459 (GRCm39) missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20,290,307 (GRCm39) missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20,268,361 (GRCm39) missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20,593,791 (GRCm39) missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20,592,971 (GRCm39) missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20,271,451 (GRCm39) missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20,447,623 (GRCm39) missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20,187,419 (GRCm39) missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20,345,839 (GRCm39) missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20,654,325 (GRCm39) missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20,279,484 (GRCm39) missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20,140,600 (GRCm39) critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20,271,007 (GRCm39) missense probably benign
IGL02389:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20,269,710 (GRCm39) missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20,632,642 (GRCm39) missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20,484,645 (GRCm39) missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20,592,983 (GRCm39) missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20,434,425 (GRCm39) missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20,462,389 (GRCm39) missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20,143,731 (GRCm39) missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20,380,934 (GRCm39) missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20,590,480 (GRCm39) missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20,621,126 (GRCm39) missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20,628,976 (GRCm39) missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20,290,253 (GRCm39) splice site probably benign
IGL02752:Pkhd1 APN 1 20,623,815 (GRCm39) missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20,431,235 (GRCm39) missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20,678,640 (GRCm39) nonsense probably null
IGL02960:Pkhd1 APN 1 20,447,670 (GRCm39) missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20,593,187 (GRCm39) missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20,592,923 (GRCm39) missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20,635,857 (GRCm39) missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20,268,395 (GRCm39) missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20,271,243 (GRCm39) missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20,151,524 (GRCm39) splice site probably benign
IGL03375:Pkhd1 APN 1 20,187,247 (GRCm39) missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20,270,894 (GRCm39) missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20,593,118 (GRCm39) missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20,607,589 (GRCm39) missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20,681,638 (GRCm39) intron probably benign
P0035:Pkhd1 UTSW 1 20,187,571 (GRCm39) missense probably benign 0.00
PIT4260001:Pkhd1 UTSW 1 20,293,130 (GRCm39) missense possibly damaging 0.51
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0115:Pkhd1 UTSW 1 20,420,714 (GRCm39) missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20,429,141 (GRCm39) missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20,610,624 (GRCm39) missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20,620,046 (GRCm39) splice site probably null
R0323:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20,451,771 (GRCm39) missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20,188,012 (GRCm39) missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20,629,693 (GRCm39) missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20,380,738 (GRCm39) splice site probably benign
R0550:Pkhd1 UTSW 1 20,417,447 (GRCm39) missense probably null 1.00
R0584:Pkhd1 UTSW 1 20,309,660 (GRCm39) nonsense probably null
R0586:Pkhd1 UTSW 1 20,594,335 (GRCm39) missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20,271,114 (GRCm39) missense probably damaging 1.00
R0634:Pkhd1 UTSW 1 20,187,698 (GRCm39) missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20,594,454 (GRCm39) missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20,268,331 (GRCm39) missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20,187,708 (GRCm39) missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20,420,745 (GRCm39) missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20,269,605 (GRCm39) missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20,271,483 (GRCm39) missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20,187,950 (GRCm39) missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20,593,053 (GRCm39) missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20,637,680 (GRCm39) missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20,641,629 (GRCm39) missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20,625,447 (GRCm39) splice site probably benign
R1411:Pkhd1 UTSW 1 20,444,120 (GRCm39) missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20,604,782 (GRCm39) missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20,593,207 (GRCm39) missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20,187,625 (GRCm39) missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20,417,664 (GRCm39) missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20,188,049 (GRCm39) missense probably benign
R1617:Pkhd1 UTSW 1 20,268,274 (GRCm39) missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20,593,121 (GRCm39) missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20,654,353 (GRCm39) missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20,621,064 (GRCm39) splice site probably benign
R1753:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20,635,935 (GRCm39) missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20,655,376 (GRCm39) splice site probably benign
R1822:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20,187,293 (GRCm39) missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20,685,491 (GRCm39) critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20,636,980 (GRCm39) critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20,151,524 (GRCm39) splice site probably benign
R1969:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20,187,284 (GRCm39) missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20,269,683 (GRCm39) missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20,270,893 (GRCm39) missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20,683,036 (GRCm39) missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20,271,559 (GRCm39) missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20,623,798 (GRCm39) nonsense probably null
R2142:Pkhd1 UTSW 1 20,594,119 (GRCm39) missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20,484,444 (GRCm39) critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20,623,741 (GRCm39) missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20,607,584 (GRCm39) missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20,635,863 (GRCm39) missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20,604,759 (GRCm39) critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20,271,073 (GRCm39) missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20,271,079 (GRCm39) missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20,271,389 (GRCm39) missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20,279,406 (GRCm39) missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20,293,185 (GRCm39) missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20,174,823 (GRCm39) missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20,625,353 (GRCm39) missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20,655,879 (GRCm39) missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20,128,524 (GRCm39) makesense probably null
R3838:Pkhd1 UTSW 1 20,604,853 (GRCm39) missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20,628,947 (GRCm39) missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20,271,151 (GRCm39) missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20,382,362 (GRCm39) nonsense probably null
R3926:Pkhd1 UTSW 1 20,621,097 (GRCm39) missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20,633,910 (GRCm39) missense probably benign 0.06
R4184:Pkhd1 UTSW 1 20,279,501 (GRCm39) missense probably benign 0.03
R4255:Pkhd1 UTSW 1 20,664,158 (GRCm39) missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20,128,608 (GRCm39) missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20,128,841 (GRCm39) missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20,484,516 (GRCm39) missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20,309,635 (GRCm39) missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20,593,538 (GRCm39) missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20,282,082 (GRCm39) missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20,604,943 (GRCm39) missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20,683,633 (GRCm39) missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20,271,092 (GRCm39) missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20,573,280 (GRCm39) missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20,434,391 (GRCm39) missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20,151,452 (GRCm39) missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20,594,354 (GRCm39) missense probably benign
R4750:Pkhd1 UTSW 1 20,594,336 (GRCm39) missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20,269,639 (GRCm39) missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20,607,625 (GRCm39) missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20,140,712 (GRCm39) missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20,279,450 (GRCm39) missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20,358,429 (GRCm39) missense probably null 0.01
R5062:Pkhd1 UTSW 1 20,655,935 (GRCm39) missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20,655,415 (GRCm39) missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20,279,448 (GRCm39) missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20,617,565 (GRCm39) missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20,345,865 (GRCm39) missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20,604,769 (GRCm39) missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20,420,635 (GRCm39) critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20,636,094 (GRCm39) missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20,520,528 (GRCm39) missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20,593,658 (GRCm39) missense probably damaging 0.96
R5346:Pkhd1 UTSW 1 20,462,321 (GRCm39) missense probably benign
R5431:Pkhd1 UTSW 1 20,188,060 (GRCm39) missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20,309,609 (GRCm39) missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20,271,380 (GRCm39) missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20,447,628 (GRCm39) missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20,151,476 (GRCm39) missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20,593,366 (GRCm39) missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20,143,750 (GRCm39) missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20,628,850 (GRCm39) missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20,658,755 (GRCm39) missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20,617,685 (GRCm39) missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20,593,875 (GRCm39) nonsense probably null
R5760:Pkhd1 UTSW 1 20,143,778 (GRCm39) missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20,279,409 (GRCm39) missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20,128,824 (GRCm39) missense probably benign
R5810:Pkhd1 UTSW 1 20,270,897 (GRCm39) missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20,269,629 (GRCm39) missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20,128,902 (GRCm39) missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20,271,307 (GRCm39) missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20,451,685 (GRCm39) missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20,444,960 (GRCm39) nonsense probably null
R5852:Pkhd1 UTSW 1 20,447,632 (GRCm39) missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20,590,434 (GRCm39) missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20,593,994 (GRCm39) missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20,282,175 (GRCm39) missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20,655,927 (GRCm39) missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20,271,047 (GRCm39) missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20,682,929 (GRCm39) missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20,128,563 (GRCm39) missense probably benign
R6886:Pkhd1 UTSW 1 20,417,504 (GRCm39) missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20,593,739 (GRCm39) missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20,604,925 (GRCm39) missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20,632,675 (GRCm39) missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20,628,943 (GRCm39) missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20,593,350 (GRCm39) missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20,617,743 (GRCm39) missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20,664,177 (GRCm39) missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20,271,197 (GRCm39) missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20,309,528 (GRCm39) missense not run
R7436:Pkhd1 UTSW 1 20,270,925 (GRCm39) missense probably benign
R7473:Pkhd1 UTSW 1 20,619,980 (GRCm39) missense probably damaging 0.99
R7578:Pkhd1 UTSW 1 20,417,585 (GRCm39) missense probably damaging 1.00
R7751:Pkhd1 UTSW 1 20,271,149 (GRCm39) missense probably damaging 1.00
R7755:Pkhd1 UTSW 1 20,617,717 (GRCm39) missense probably damaging 0.98
R7757:Pkhd1 UTSW 1 20,632,639 (GRCm39) missense probably damaging 1.00
R7832:Pkhd1 UTSW 1 20,573,223 (GRCm39) missense probably damaging 1.00
R7834:Pkhd1 UTSW 1 20,382,273 (GRCm39) missense probably benign
R7920:Pkhd1 UTSW 1 20,345,759 (GRCm39) missense probably damaging 1.00
R8014:Pkhd1 UTSW 1 20,579,115 (GRCm39) critical splice donor site probably null
R8034:Pkhd1 UTSW 1 20,451,662 (GRCm39) missense possibly damaging 0.94
R8085:Pkhd1 UTSW 1 20,683,639 (GRCm39) missense probably damaging 1.00
R8087:Pkhd1 UTSW 1 20,593,313 (GRCm39) missense probably damaging 1.00
R8103:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R8122:Pkhd1 UTSW 1 20,632,682 (GRCm39) missense probably damaging 1.00
R8273:Pkhd1 UTSW 1 20,607,644 (GRCm39) splice site probably benign
R8485:Pkhd1 UTSW 1 20,593,257 (GRCm39) missense probably damaging 1.00
R8504:Pkhd1 UTSW 1 20,590,432 (GRCm39) missense probably benign 0.10
R8544:Pkhd1 UTSW 1 20,593,199 (GRCm39) missense probably damaging 1.00
R8692:Pkhd1 UTSW 1 20,462,374 (GRCm39) missense probably damaging 1.00
R8787:Pkhd1 UTSW 1 20,358,461 (GRCm39) missense probably damaging 0.99
R8853:Pkhd1 UTSW 1 20,143,679 (GRCm39) critical splice donor site probably null
R8907:Pkhd1 UTSW 1 20,187,785 (GRCm39) missense possibly damaging 0.88
R8934:Pkhd1 UTSW 1 20,462,234 (GRCm39) critical splice donor site probably null
R8990:Pkhd1 UTSW 1 20,417,529 (GRCm39) missense probably benign 0.00
R8998:Pkhd1 UTSW 1 20,434,425 (GRCm39) missense probably damaging 1.00
R9024:Pkhd1 UTSW 1 20,592,975 (GRCm39) missense probably benign 0.24
R9035:Pkhd1 UTSW 1 20,573,176 (GRCm39) missense probably damaging 1.00
R9092:Pkhd1 UTSW 1 20,632,586 (GRCm39) missense probably benign 0.00
R9238:Pkhd1 UTSW 1 20,604,799 (GRCm39) missense possibly damaging 0.89
R9258:Pkhd1 UTSW 1 20,444,174 (GRCm39) missense probably damaging 0.99
R9262:Pkhd1 UTSW 1 20,618,351 (GRCm39) missense probably benign 0.01
R9297:Pkhd1 UTSW 1 20,293,118 (GRCm39) missense probably benign 0.06
R9452:Pkhd1 UTSW 1 20,682,953 (GRCm39) missense possibly damaging 0.77
R9515:Pkhd1 UTSW 1 20,637,741 (GRCm39) missense probably damaging 1.00
R9540:Pkhd1 UTSW 1 20,269,570 (GRCm39) missense probably benign 0.00
R9542:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R9629:Pkhd1 UTSW 1 20,462,437 (GRCm39) missense possibly damaging 0.63
R9644:Pkhd1 UTSW 1 20,617,690 (GRCm39) missense probably benign 0.04
R9739:Pkhd1 UTSW 1 20,420,708 (GRCm39) missense probably damaging 1.00
R9767:Pkhd1 UTSW 1 20,484,636 (GRCm39) missense probably benign
R9781:Pkhd1 UTSW 1 20,187,665 (GRCm39) missense possibly damaging 0.95
R9803:Pkhd1 UTSW 1 20,637,073 (GRCm39) missense probably damaging 1.00
X0012:Pkhd1 UTSW 1 20,444,150 (GRCm39) missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20,590,450 (GRCm39) missense probably damaging 1.00
Z1176:Pkhd1 UTSW 1 20,593,971 (GRCm39) missense possibly damaging 0.81
Z1177:Pkhd1 UTSW 1 20,593,845 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,380,818 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,188,107 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,621,243 (GRCm39) missense probably benign
Z1177:Pkhd1 UTSW 1 20,594,162 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGTCTGTTGAGCAGTGATAACC -3'
(R):5'- ATGTTGTCCTGCAAGGAGAGGAGC -3'

Sequencing Primer
(F):5'- GCAGTGATAACCTGGTTCACC -3'
(R):5'- GCTTGAAAGCCTAAGTGACTTC -3'
Posted On 2013-07-11