Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4520001:Adgrb1'

555200

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

Bai1, B830018M07Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4520001 (G1)

Quality Score

151.008

Status

Not validated

Chromosome

Chromosomal Location

74516195-74589465 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74541659 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 564 (D564G)

Ref Sequence

ENSEMBL: ENSMUSP00000046097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042035
AA Change: D564G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: D564G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186360
AA Change: D564G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: D564G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187485

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Coding Region Coverage

1x: 93.5%
3x: 91.1%
10x: 86.1%
20x: 75.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy1	A	G	11: 7,167,133	N1000S	probably damaging	Het
Ankmy2	A	G	12: 36,157,391	E12G	probably benign	Het
Arid1a	C	T	4: 133,681,916	S1375N	unknown	Het
Atp1a2	G	A	1: 172,279,374	A793V	probably benign	Het
Atp8b1	T	C	18: 64,568,180	Y369C	probably benign	Het
Catsperg2	A	G	7: 29,710,161	Y536H	possibly damaging	Het
Ccdc178	A	G	18: 22,067,413	Y445H	probably damaging	Het
Cep170	G	T	1: 176,780,199	N230K	unknown	Het
Cftr	A	G	6: 18,277,843	I977V	probably benign	Het
Chek2	A	G	5: 110,863,329	Y331C	probably damaging	Het
Chst13	A	T	6: 90,309,185	I265K	probably benign	Het
Coil	T	C	11: 88,981,611	M266T	probably benign	Het
Col16a1	T	A	4: 130,051,663	C28S	unknown	Het
Col3a1	T	C	1: 45,335,783		probably null	Het
Csmd1	C	T	8: 15,906,023	V3395M	probably benign	Het
Cyp51	A	G	5: 4,101,200	V143A	probably damaging	Het
Eif2ak1	C	T	5: 143,899,209	Q573*	probably null	Het
Eif2ak4	T	A	2: 118,462,327	I1344N	probably damaging	Het
Fam160a1	G	A	3: 85,672,472	Q809*	probably null	Het
Gen1	A	G	12: 11,241,508	V825A	probably benign	Het
Gm28042	A	T	2: 120,039,667	K696*	probably null	Het
Gm4952	A	G	19: 12,624,684	Y152C	probably benign	Het
Hdac3	G	A	18: 37,941,764	T308I	probably damaging	Het
Hpx	T	C	7: 105,592,134	T357A	probably benign	Het
Hscb	A	T	5: 110,835,985	Y139N	probably damaging	Het
Kcnk9	T	A	15: 72,512,483	H282L	probably benign	Het
Kdm2b	G	A	5: 122,941,047	T287M	probably damaging	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kmt2c	A	C	5: 25,315,666	N1815K	probably benign	Het
Ktn1	C	T	14: 47,686,317	T511M	probably damaging	Het
Lrp1	C	G	10: 127,607,974	Q141H	possibly damaging	Het
Lrrc43	T	C	5: 123,492,467	V131A	possibly damaging	Het
Man1b1	T	A	2: 25,343,270	H218Q	probably damaging	Het
Mapk8ip2	T	A	15: 89,460,697	C766S	probably damaging	Het
Mfn1	A	G	3: 32,561,546	N353D	probably benign	Het
Mtcl1	A	T	17: 66,385,912	L474Q	possibly damaging	Het
Mtr	T	A	13: 12,197,985	R915*	probably null	Het
Myh6	C	A	14: 54,950,124	V1263L	probably benign	Het
Nt5m	C	A	11: 59,874,589	L148M	probably benign	Het
Olfr1053	T	C	2: 86,314,798	I163V	possibly damaging	Het
Olfr1200	A	G	2: 88,767,577	V246A	possibly damaging	Het
Olfr574	A	T	7: 102,948,714	D83V	probably damaging	Het
Pbrm1	T	A	14: 31,067,861	F811I	probably damaging	Het
Pcnt	A	G	10: 76,420,235	S724P	probably damaging	Het
Pfdn5	C	A	15: 102,328,723	D98E	probably benign	Het
Ptprs	G	A	17: 56,414,980	P1715S	probably damaging	Het
Rtkn2	T	A	10: 67,987,461	L65Q	probably damaging	Het
Scn2a	G	A	2: 65,688,419	R379H	probably damaging	Het
Scn5a	G	T	9: 119,534,570	D501E	possibly damaging	Het
Spn	C	A	7: 127,136,439	G299W	probably damaging	Het
St6galnac1	T	C	11: 116,769,349	N46S	probably benign	Het
Stx19	A	G	16: 62,822,508	D229G	probably benign	Het
Tmc6	A	T	11: 117,772,730	M552K	possibly damaging	Het
Tnpo3	G	C	6: 29,555,222	D787E	possibly damaging	Het
Tyw5	T	C	1: 57,388,515	Y310C	probably damaging	Het
Vmn2r15	A	G	5: 109,287,005	F611S	probably damaging	Het
Vmn2r49	C	T	7: 9,989,061	M95I	probably benign	Het
Wfdc8	A	G	2: 164,603,303	S131P	probably benign	Het
Zfp407	A	T	18: 84,432,420	M1597K	probably damaging	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74586835	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74548357	splice site	probably benign
IGL01874:Adgrb1	APN	15	74541574	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74541575	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74529782	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74540477	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74574112	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74586805	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74588294	splice site	probably benign
IGL02678:Adgrb1	APN	15	74538328	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74547622	missense	probably damaging	0.98
Bunting	UTSW	15	74543701	missense	probably null	0.94
R0193:Adgrb1	UTSW	15	74572156	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74586807	missense	probably benign
R0267:Adgrb1	UTSW	15	74529389	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74587149	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74543349	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74541559	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74540892	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74548549	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74547685	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74550039	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74588107	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74529343	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74541827	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74529540	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74580586	nonsense	probably null
R1895:Adgrb1	UTSW	15	74540465	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74539877	splice site	probably benign
R2114:Adgrb1	UTSW	15	74540562	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74529908	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74547704	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74545015	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74588308	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74582943	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74543662	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74577453	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74584429	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74588114	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74529479	nonsense	probably null
R4760:Adgrb1	UTSW	15	74571463	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74588129	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74587022	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74572162	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74529815	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74543701	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74577499	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74550027	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74541574	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74538370	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74540459	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74588143	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74529361	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74550024	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74529901	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74574110	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74569881	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74569948	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74569884	missense	probably benign
R7283:Adgrb1	UTSW	15	74580663	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74548569	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74543638	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACTTCCCTACTGATCCTGGG -3'
(R):5'- TCTTACCTGTGGCATTGCG -3'

Sequencing Primer
(F):5'- ACTGATCCTGGGCCCTAC -3'
(R):5'- TGGGGTCTCCTTCCAGAC -3'

Posted On

2019-06-07