Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4520001:Zfp407'

555209

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4520001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84432420 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1597 (M1597K)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

AlphaFold

G3UVV3

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

probably damaging
Transcript: ENSMUST00000125763
AA Change: M1597K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: M1597K

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Coding Region Coverage

1x: 93.5%
3x: 91.1%
10x: 86.1%
20x: 75.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy1	A	G	11: 7,167,133	N1000S	probably damaging	Het
Adgrb1	A	G	15: 74,541,659	D564G	probably damaging	Het
Ankmy2	A	G	12: 36,157,391	E12G	probably benign	Het
Arid1a	C	T	4: 133,681,916	S1375N	unknown	Het
Atp1a2	G	A	1: 172,279,374	A793V	probably benign	Het
Atp8b1	T	C	18: 64,568,180	Y369C	probably benign	Het
Catsperg2	A	G	7: 29,710,161	Y536H	possibly damaging	Het
Ccdc178	A	G	18: 22,067,413	Y445H	probably damaging	Het
Cep170	G	T	1: 176,780,199	N230K	unknown	Het
Cftr	A	G	6: 18,277,843	I977V	probably benign	Het
Chek2	A	G	5: 110,863,329	Y331C	probably damaging	Het
Chst13	A	T	6: 90,309,185	I265K	probably benign	Het
Coil	T	C	11: 88,981,611	M266T	probably benign	Het
Col16a1	T	A	4: 130,051,663	C28S	unknown	Het
Col3a1	T	C	1: 45,335,783		probably null	Het
Csmd1	C	T	8: 15,906,023	V3395M	probably benign	Het
Cyp51	A	G	5: 4,101,200	V143A	probably damaging	Het
Eif2ak1	C	T	5: 143,899,209	Q573*	probably null	Het
Eif2ak4	T	A	2: 118,462,327	I1344N	probably damaging	Het
Fam160a1	G	A	3: 85,672,472	Q809*	probably null	Het
Gen1	A	G	12: 11,241,508	V825A	probably benign	Het
Gm28042	A	T	2: 120,039,667	K696*	probably null	Het
Gm4952	A	G	19: 12,624,684	Y152C	probably benign	Het
Hdac3	G	A	18: 37,941,764	T308I	probably damaging	Het
Hpx	T	C	7: 105,592,134	T357A	probably benign	Het
Hscb	A	T	5: 110,835,985	Y139N	probably damaging	Het
Kcnk9	T	A	15: 72,512,483	H282L	probably benign	Het
Kdm2b	G	A	5: 122,941,047	T287M	probably damaging	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kmt2c	A	C	5: 25,315,666	N1815K	probably benign	Het
Ktn1	C	T	14: 47,686,317	T511M	probably damaging	Het
Lrp1	C	G	10: 127,607,974	Q141H	possibly damaging	Het
Lrrc43	T	C	5: 123,492,467	V131A	possibly damaging	Het
Man1b1	T	A	2: 25,343,270	H218Q	probably damaging	Het
Mapk8ip2	T	A	15: 89,460,697	C766S	probably damaging	Het
Mfn1	A	G	3: 32,561,546	N353D	probably benign	Het
Mtcl1	A	T	17: 66,385,912	L474Q	possibly damaging	Het
Mtr	T	A	13: 12,197,985	R915*	probably null	Het
Myh6	C	A	14: 54,950,124	V1263L	probably benign	Het
Nt5m	C	A	11: 59,874,589	L148M	probably benign	Het
Olfr1053	T	C	2: 86,314,798	I163V	possibly damaging	Het
Olfr1200	A	G	2: 88,767,577	V246A	possibly damaging	Het
Olfr574	A	T	7: 102,948,714	D83V	probably damaging	Het
Pbrm1	T	A	14: 31,067,861	F811I	probably damaging	Het
Pcnt	A	G	10: 76,420,235	S724P	probably damaging	Het
Pfdn5	C	A	15: 102,328,723	D98E	probably benign	Het
Ptprs	G	A	17: 56,414,980	P1715S	probably damaging	Het
Rtkn2	T	A	10: 67,987,461	L65Q	probably damaging	Het
Scn2a	G	A	2: 65,688,419	R379H	probably damaging	Het
Scn5a	G	T	9: 119,534,570	D501E	possibly damaging	Het
Spn	C	A	7: 127,136,439	G299W	probably damaging	Het
St6galnac1	T	C	11: 116,769,349	N46S	probably benign	Het
Stx19	A	G	16: 62,822,508	D229G	probably benign	Het
Tmc6	A	T	11: 117,772,730	M552K	possibly damaging	Het
Tnpo3	G	C	6: 29,555,222	D787E	possibly damaging	Het
Tyw5	T	C	1: 57,388,515	Y310C	probably damaging	Het
Vmn2r15	A	G	5: 109,287,005	F611S	probably damaging	Het
Vmn2r49	C	T	7: 9,989,061	M95I	probably benign	Het
Wfdc8	A	G	2: 164,603,303	S131P	probably benign	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
IGL03134:Zfp407	UTSW	18	84209955	missense	probably damaging	0.99
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1086:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2154:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2353:Zfp407	UTSW	18	84559880	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R3892:Zfp407	UTSW	18	84560352	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R4936:Zfp407	UTSW	18	84559464	missense	probably benign	0.00
R5194:Zfp407	UTSW	18	84561309	missense	probably benign	0.05
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
R7904:Zfp407	UTSW	18	84561256	missense	not run
R7942:Zfp407	UTSW	18	84559629	missense	probably benign	0.02
R7955:Zfp407	UTSW	18	84559291	missense	probably benign	0.02
R7988:Zfp407	UTSW	18	84559400	missense	possibly damaging	0.60
R8125:Zfp407	UTSW	18	84561185	missense	probably damaging	1.00
R8237:Zfp407	UTSW	18	84560144	missense	possibly damaging	0.87
R8364:Zfp407	UTSW	18	84552868	critical splice donor site	probably null
R8443:Zfp407	UTSW	18	84209862	missense	probably damaging	1.00
R8487:Zfp407	UTSW	18	84562770	nonsense	probably null
R8497:Zfp407	UTSW	18	84559896	missense	probably damaging	0.98
R8808:Zfp407	UTSW	18	84343060	missense	probably benign	0.17
R8848:Zfp407	UTSW	18	84560694	missense	probably damaging	1.00
R8913:Zfp407	UTSW	18	84560528	missense	probably damaging	0.99
R8962:Zfp407	UTSW	18	84558932	missense	probably damaging	1.00
R9087:Zfp407	UTSW	18	84209857	missense	probably damaging	0.96
R9452:Zfp407	UTSW	18	84562454	missense	probably benign	0.02
R9691:Zfp407	UTSW	18	84560187	missense	probably benign	0.03
R9766:Zfp407	UTSW	18	84559449	missense	probably benign	0.06
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17
Z1177:Zfp407	UTSW	18	84209954	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGTGTTCAAGAAGGAAGCTACAAATTC -3'
(R):5'- TGATGACAAGATCAGCACTGTG -3'

Sequencing Primer
(F):5'- CCAGTGACACAAATTTGAAAAGTTC -3'
(R):5'- CACTGTGCAAGAGCTGTTGTAATGAG -3'

Posted On

2019-06-07