Incidental Mutation 'PIT4431001:Olfr1248'
ID555215
Institutional Source Beutler Lab
Gene Symbol Olfr1248
Ensembl Gene ENSMUSG00000111239
Gene Nameolfactory receptor 1248
SynonymsMOR231-10, GA_x6K02T2Q125-51059648-51058725
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #PIT4431001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89617168-89618245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89617857 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 112 (I112V)
Ref Sequence ENSEMBL: ENSMUSP00000150117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111532] [ENSMUST00000216129] [ENSMUST00000216424]
Predicted Effect probably benign
Transcript: ENSMUST00000111532
SMART Domains Protein: ENSMUSP00000107157
Gene: ENSMUSG00000075081

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.2e-48 PFAM
Pfam:7tm_1 39 285 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216129
AA Change: I112V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000216424
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 90.7%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik A G 5: 146,502,512 I29V probably benign Het
5730455P16Rik C A 11: 80,363,924 C357F probably damaging Het
Actr1a A T 19: 46,382,292 probably null Het
Adcy1 C G 11: 7,064,089 Q164E possibly damaging Het
Arhgap35 A T 7: 16,561,611 S1176R possibly damaging Het
Atad2b A G 12: 5,031,795 T1235A possibly damaging Het
Atp8a2 T C 14: 59,654,626 D1091G probably benign Het
Bmp6 T C 13: 38,485,930 S397P probably benign Het
C3 A T 17: 57,206,242 N1468K probably benign Het
Ccnjl CGCG CGCGGCG 11: 43,579,707 probably benign Het
Ccr1 T C 9: 123,964,194 I100V probably benign Het
Cep162 T A 9: 87,244,345 R171S probably benign Het
Chd8 T C 14: 52,218,249 H994R probably damaging Het
Cntn3 T A 6: 102,464,566 K6N probably benign Het
Cope A G 8: 70,312,767 E289G probably damaging Het
Cpne8 T G 15: 90,551,975 E279A probably damaging Het
Cyp11a1 A T 9: 58,016,272 probably null Het
Dcp2 A G 18: 44,412,571 K333R probably benign Het
Dpp6 G T 5: 27,631,498 V329F probably benign Het
Drc1 T A 5: 30,347,073 D186E probably damaging Het
Dsc2 G A 18: 20,046,277 Q245* probably null Het
Eef1e1 T C 13: 38,658,962 E11G probably damaging Het
Emilin2 G A 17: 71,255,995 P915S probably benign Het
Fam214b C A 4: 43,036,024 G236C probably damaging Het
Fpgt A G 3: 155,086,785 M535T possibly damaging Het
Fxyd3 G A 7: 31,071,355 L37F probably damaging Het
Gal3st2c T A 1: 94,008,112 I62N probably damaging Het
Gdpd3 T C 7: 126,766,475 I2T probably benign Het
Gm9611 T C 14: 42,293,931 M169V Het
Ints3 G A 3: 90,396,460 T720I probably damaging Het
Itpr2 T G 6: 146,354,720 M992L probably benign Het
L3mbtl2 T A 15: 81,676,307 H256Q probably benign Het
Lama2 T C 10: 27,101,430 T1918A probably damaging Het
Lpcat2b G A 5: 107,434,131 G442D probably damaging Het
Lrp1b C T 2: 41,004,755 V2268M Het
Macc1 T C 12: 119,446,511 L338P probably benign Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Mtr C T 13: 12,212,443 V772M probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Myo5c A G 9: 75,252,571 I294V possibly damaging Het
Ncam1 A T 9: 49,798,693 F13I probably benign Het
Paqr6 A T 3: 88,365,777 I52F possibly damaging Het
Pde2a T G 7: 101,501,897 V271G probably damaging Het
Pde7b T C 10: 20,400,545 H405R possibly damaging Het
Plxnb1 A G 9: 109,100,718 Y214C probably damaging Het
Pmp22 T C 11: 63,151,241 F101L probably benign Het
Pold1 A G 7: 44,538,894 L520P probably damaging Het
Pramel1 A G 4: 143,398,390 T295A possibly damaging Het
Psg20 A T 7: 18,674,550 I415N probably damaging Het
Ptcd2 T A 13: 99,340,019 R71* probably null Het
Ptgs1 A T 2: 36,240,680 N197I probably damaging Het
Rbfox3 T C 11: 118,495,221 D333G probably damaging Het
Rfx7 T A 9: 72,617,971 H814Q probably benign Het
Rptn TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG 3: 93,397,397 probably benign Het
Serpina3i A T 12: 104,265,173 H23L probably benign Het
Sipa1l1 T A 12: 82,396,516 V860E probably benign Het
Slc12a1 T A 2: 125,190,204 Y592N possibly damaging Het
Slco2a1 T C 9: 103,050,268 F120S probably damaging Het
Smyd4 T C 11: 75,403,513 F740S probably damaging Het
Sppl2a T C 2: 126,923,476 Y242C probably damaging Het
Sqle A G 15: 59,323,660 K288R probably benign Het
Tbc1d17 A G 7: 44,845,074 S246P probably benign Het
Tenm3 G A 8: 48,235,607 T2315M probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Thumpd3 T A 6: 113,059,978 N279K probably benign Het
Tmed5 T A 5: 108,130,021 H95L possibly damaging Het
Tmem161a T C 8: 70,182,024 L443P probably damaging Het
Ttc38 C A 15: 85,836,127 Q97K probably benign Het
Unc13c C A 9: 73,749,547 C1124F probably damaging Het
Vmn2r102 A G 17: 19,676,696 T102A possibly damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Xkr5 A T 8: 18,934,345 S394T possibly damaging Het
Zan C T 5: 137,392,064 C4747Y unknown Het
Zfp804a T C 2: 82,259,192 F1122L probably benign Het
Other mutations in Olfr1248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02871:Olfr1248 APN 2 89618160 missense probably benign 0.00
R0504:Olfr1248 UTSW 2 89618094 missense probably damaging 1.00
R0761:Olfr1248 UTSW 2 89617835 missense probably damaging 1.00
R2176:Olfr1248 UTSW 2 89617580 missense possibly damaging 0.54
R3722:Olfr1248 UTSW 2 89618159 missense possibly damaging 0.88
R4030:Olfr1248 UTSW 2 89617863 missense probably damaging 0.99
R4440:Olfr1248 UTSW 2 89618168 missense probably damaging 1.00
R4756:Olfr1248 UTSW 2 89617470 missense possibly damaging 0.86
R4981:Olfr1248 UTSW 2 89617425 missense probably damaging 1.00
R5678:Olfr1248 UTSW 2 89617281 missense probably benign
R6503:Olfr1248 UTSW 2 89617578 missense possibly damaging 0.76
R6569:Olfr1248 UTSW 2 89618015 missense possibly damaging 0.83
R6770:Olfr1248 UTSW 2 89617862 missense probably benign 0.39
R7823:Olfr1248 UTSW 2 89617269 makesense probably null
RF008:Olfr1248 UTSW 2 89617367 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGGTCAATGACATTGGGTCCAC -3'
(R):5'- AACCTGCTCATTGTGGGGAC -3'

Sequencing Primer
(F):5'- TCAATGACATTGGGTCCACAAAAAG -3'
(R):5'- ACAGTGATTGCCAGCCC -3'
Posted On2019-06-07