Incidental Mutation 'PIT4431001:Thumpd3'
ID555232
Institutional Source Beutler Lab
Gene Symbol Thumpd3
Ensembl Gene ENSMUSG00000030264
Gene NameTHUMP domain containing 3
SynonymsGtrosa26as
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #PIT4431001 (G1)
Quality Score167.009
Status Not validated
Chromosome6
Chromosomal Location113046225-113068273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113059978 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 279 (N279K)
Ref Sequence ENSEMBL: ENSMUSP00000032398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032398] [ENSMUST00000155378]
Predicted Effect probably benign
Transcript: ENSMUST00000032398
AA Change: N279K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000032398
Gene: ENSMUSG00000030264
AA Change: N279K

DomainStartEndE-ValueType
low complexity region 142 151 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
THUMP 190 287 4.75e-12 SMART
Pfam:UPF0020 294 480 1.2e-57 PFAM
Pfam:Methyltransf_26 322 449 6.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155378
SMART Domains Protein: ENSMUSP00000120509
Gene: ENSMUSG00000030264

DomainStartEndE-ValueType
low complexity region 142 151 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
Blast:THUMP 190 222 2e-13 BLAST
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 90.7%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik A G 5: 146,502,512 I29V probably benign Het
5730455P16Rik C A 11: 80,363,924 C357F probably damaging Het
Actr1a A T 19: 46,382,292 probably null Het
Adcy1 C G 11: 7,064,089 Q164E possibly damaging Het
Arhgap35 A T 7: 16,561,611 S1176R possibly damaging Het
Atad2b A G 12: 5,031,795 T1235A possibly damaging Het
Atp8a2 T C 14: 59,654,626 D1091G probably benign Het
Bmp6 T C 13: 38,485,930 S397P probably benign Het
C3 A T 17: 57,206,242 N1468K probably benign Het
Ccnjl CGCG CGCGGCG 11: 43,579,707 probably benign Het
Ccr1 T C 9: 123,964,194 I100V probably benign Het
Cep162 T A 9: 87,244,345 R171S probably benign Het
Chd8 T C 14: 52,218,249 H994R probably damaging Het
Cntn3 T A 6: 102,464,566 K6N probably benign Het
Cope A G 8: 70,312,767 E289G probably damaging Het
Cpne8 T G 15: 90,551,975 E279A probably damaging Het
Cyp11a1 A T 9: 58,016,272 probably null Het
Dcp2 A G 18: 44,412,571 K333R probably benign Het
Dpp6 G T 5: 27,631,498 V329F probably benign Het
Drc1 T A 5: 30,347,073 D186E probably damaging Het
Dsc2 G A 18: 20,046,277 Q245* probably null Het
Eef1e1 T C 13: 38,658,962 E11G probably damaging Het
Emilin2 G A 17: 71,255,995 P915S probably benign Het
Fam214b C A 4: 43,036,024 G236C probably damaging Het
Fpgt A G 3: 155,086,785 M535T possibly damaging Het
Fxyd3 G A 7: 31,071,355 L37F probably damaging Het
Gal3st2c T A 1: 94,008,112 I62N probably damaging Het
Gdpd3 T C 7: 126,766,475 I2T probably benign Het
Gm9611 T C 14: 42,293,931 M169V Het
Ints3 G A 3: 90,396,460 T720I probably damaging Het
Itpr2 T G 6: 146,354,720 M992L probably benign Het
L3mbtl2 T A 15: 81,676,307 H256Q probably benign Het
Lama2 T C 10: 27,101,430 T1918A probably damaging Het
Lpcat2b G A 5: 107,434,131 G442D probably damaging Het
Lrp1b C T 2: 41,004,755 V2268M Het
Macc1 T C 12: 119,446,511 L338P probably benign Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Mtr C T 13: 12,212,443 V772M probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Myo5c A G 9: 75,252,571 I294V possibly damaging Het
Ncam1 A T 9: 49,798,693 F13I probably benign Het
Olfr1248 T C 2: 89,617,857 I112V probably benign Het
Paqr6 A T 3: 88,365,777 I52F possibly damaging Het
Pde2a T G 7: 101,501,897 V271G probably damaging Het
Pde7b T C 10: 20,400,545 H405R possibly damaging Het
Plxnb1 A G 9: 109,100,718 Y214C probably damaging Het
Pmp22 T C 11: 63,151,241 F101L probably benign Het
Pold1 A G 7: 44,538,894 L520P probably damaging Het
Pramel1 A G 4: 143,398,390 T295A possibly damaging Het
Psg20 A T 7: 18,674,550 I415N probably damaging Het
Ptcd2 T A 13: 99,340,019 R71* probably null Het
Ptgs1 A T 2: 36,240,680 N197I probably damaging Het
Rbfox3 T C 11: 118,495,221 D333G probably damaging Het
Rfx7 T A 9: 72,617,971 H814Q probably benign Het
Rptn TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG 3: 93,397,397 probably benign Het
Serpina3i A T 12: 104,265,173 H23L probably benign Het
Sipa1l1 T A 12: 82,396,516 V860E probably benign Het
Slc12a1 T A 2: 125,190,204 Y592N possibly damaging Het
Slco2a1 T C 9: 103,050,268 F120S probably damaging Het
Smyd4 T C 11: 75,403,513 F740S probably damaging Het
Sppl2a T C 2: 126,923,476 Y242C probably damaging Het
Sqle A G 15: 59,323,660 K288R probably benign Het
Tbc1d17 A G 7: 44,845,074 S246P probably benign Het
Tenm3 G A 8: 48,235,607 T2315M probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmed5 T A 5: 108,130,021 H95L possibly damaging Het
Tmem161a T C 8: 70,182,024 L443P probably damaging Het
Ttc38 C A 15: 85,836,127 Q97K probably benign Het
Unc13c C A 9: 73,749,547 C1124F probably damaging Het
Vmn2r102 A G 17: 19,676,696 T102A possibly damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Xkr5 A T 8: 18,934,345 S394T possibly damaging Het
Zan C T 5: 137,392,064 C4747Y unknown Het
Zfp804a T C 2: 82,259,192 F1122L probably benign Het
Other mutations in Thumpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Thumpd3 APN 6 113047661 missense possibly damaging 0.94
IGL01113:Thumpd3 APN 6 113060060 missense probably benign 0.36
IGL01525:Thumpd3 APN 6 113047636 missense probably damaging 1.00
IGL01560:Thumpd3 APN 6 113063159 missense possibly damaging 0.88
IGL01734:Thumpd3 APN 6 113066845 missense probably damaging 1.00
IGL01814:Thumpd3 APN 6 113063151 missense possibly damaging 0.64
IGL01901:Thumpd3 APN 6 113059971 missense probably benign 0.09
IGL01977:Thumpd3 APN 6 113059966 missense possibly damaging 0.96
IGL02697:Thumpd3 APN 6 113067295 missense probably benign 0.03
IGL02805:Thumpd3 APN 6 113066797 missense probably damaging 1.00
R0139:Thumpd3 UTSW 6 113067801 missense probably benign 0.00
R0386:Thumpd3 UTSW 6 113065660 critical splice donor site probably null
R1975:Thumpd3 UTSW 6 113055877 missense possibly damaging 0.92
R2125:Thumpd3 UTSW 6 113066788 missense probably benign 0.02
R3709:Thumpd3 UTSW 6 113055691 missense possibly damaging 0.65
R5439:Thumpd3 UTSW 6 113066864 splice site silent
R6074:Thumpd3 UTSW 6 113060010 missense possibly damaging 0.70
R6406:Thumpd3 UTSW 6 113055963 missense probably damaging 0.98
R7411:Thumpd3 UTSW 6 113056111 missense possibly damaging 0.92
R7464:Thumpd3 UTSW 6 113055769 missense probably benign 0.00
R7465:Thumpd3 UTSW 6 113047631 missense probably damaging 1.00
R7779:Thumpd3 UTSW 6 113059989 missense probably damaging 0.98
RF010:Thumpd3 UTSW 6 113056045 missense probably damaging 1.00
Z1088:Thumpd3 UTSW 6 113056030 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAAGAAAGTTCTCTGTGTTGTGGC -3'
(R):5'- CTAACTAAGAAAATGGTTTTGGGAGT -3'

Sequencing Primer
(F):5'- TGGCCTTGAACTTACAGAGATCCG -3'
(R):5'- AAGAAAATGGTTTTGGGAGTTTTTG -3'
Posted On2019-06-07