Incidental Mutation 'PIT4431001:Arhgap35'
ID555234
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4431001 (G1)
Quality Score140.008
Status Not validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16561611 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1176 (S1176R)
Ref Sequence ENSEMBL: ENSMUSP00000075242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075845
AA Change: S1176R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: S1176R

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171937
AA Change: S1176R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: S1176R

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 90.7%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik A G 5: 146,502,512 I29V probably benign Het
5730455P16Rik C A 11: 80,363,924 C357F probably damaging Het
Actr1a A T 19: 46,382,292 probably null Het
Adcy1 C G 11: 7,064,089 Q164E possibly damaging Het
Atad2b A G 12: 5,031,795 T1235A possibly damaging Het
Atp8a2 T C 14: 59,654,626 D1091G probably benign Het
Bmp6 T C 13: 38,485,930 S397P probably benign Het
C3 A T 17: 57,206,242 N1468K probably benign Het
Ccnjl CGCG CGCGGCG 11: 43,579,707 probably benign Het
Ccr1 T C 9: 123,964,194 I100V probably benign Het
Cep162 T A 9: 87,244,345 R171S probably benign Het
Chd8 T C 14: 52,218,249 H994R probably damaging Het
Cntn3 T A 6: 102,464,566 K6N probably benign Het
Cope A G 8: 70,312,767 E289G probably damaging Het
Cpne8 T G 15: 90,551,975 E279A probably damaging Het
Cyp11a1 A T 9: 58,016,272 probably null Het
Dcp2 A G 18: 44,412,571 K333R probably benign Het
Dpp6 G T 5: 27,631,498 V329F probably benign Het
Drc1 T A 5: 30,347,073 D186E probably damaging Het
Dsc2 G A 18: 20,046,277 Q245* probably null Het
Eef1e1 T C 13: 38,658,962 E11G probably damaging Het
Emilin2 G A 17: 71,255,995 P915S probably benign Het
Fam214b C A 4: 43,036,024 G236C probably damaging Het
Fpgt A G 3: 155,086,785 M535T possibly damaging Het
Fxyd3 G A 7: 31,071,355 L37F probably damaging Het
Gal3st2c T A 1: 94,008,112 I62N probably damaging Het
Gdpd3 T C 7: 126,766,475 I2T probably benign Het
Gm9611 T C 14: 42,293,931 M169V Het
Ints3 G A 3: 90,396,460 T720I probably damaging Het
Itpr2 T G 6: 146,354,720 M992L probably benign Het
L3mbtl2 T A 15: 81,676,307 H256Q probably benign Het
Lama2 T C 10: 27,101,430 T1918A probably damaging Het
Lpcat2b G A 5: 107,434,131 G442D probably damaging Het
Lrp1b C T 2: 41,004,755 V2268M Het
Macc1 T C 12: 119,446,511 L338P probably benign Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Mtr C T 13: 12,212,443 V772M probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Myo5c A G 9: 75,252,571 I294V possibly damaging Het
Ncam1 A T 9: 49,798,693 F13I probably benign Het
Olfr1248 T C 2: 89,617,857 I112V probably benign Het
Paqr6 A T 3: 88,365,777 I52F possibly damaging Het
Pde2a T G 7: 101,501,897 V271G probably damaging Het
Pde7b T C 10: 20,400,545 H405R possibly damaging Het
Plxnb1 A G 9: 109,100,718 Y214C probably damaging Het
Pmp22 T C 11: 63,151,241 F101L probably benign Het
Pold1 A G 7: 44,538,894 L520P probably damaging Het
Pramel1 A G 4: 143,398,390 T295A possibly damaging Het
Psg20 A T 7: 18,674,550 I415N probably damaging Het
Ptcd2 T A 13: 99,340,019 R71* probably null Het
Ptgs1 A T 2: 36,240,680 N197I probably damaging Het
Rbfox3 T C 11: 118,495,221 D333G probably damaging Het
Rfx7 T A 9: 72,617,971 H814Q probably benign Het
Rptn TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG 3: 93,397,397 probably benign Het
Serpina3i A T 12: 104,265,173 H23L probably benign Het
Sipa1l1 T A 12: 82,396,516 V860E probably benign Het
Slc12a1 T A 2: 125,190,204 Y592N possibly damaging Het
Slco2a1 T C 9: 103,050,268 F120S probably damaging Het
Smyd4 T C 11: 75,403,513 F740S probably damaging Het
Sppl2a T C 2: 126,923,476 Y242C probably damaging Het
Sqle A G 15: 59,323,660 K288R probably benign Het
Tbc1d17 A G 7: 44,845,074 S246P probably benign Het
Tenm3 G A 8: 48,235,607 T2315M probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Thumpd3 T A 6: 113,059,978 N279K probably benign Het
Tmed5 T A 5: 108,130,021 H95L possibly damaging Het
Tmem161a T C 8: 70,182,024 L443P probably damaging Het
Ttc38 C A 15: 85,836,127 Q97K probably benign Het
Unc13c C A 9: 73,749,547 C1124F probably damaging Het
Vmn2r102 A G 17: 19,676,696 T102A possibly damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Xkr5 A T 8: 18,934,345 S394T possibly damaging Het
Zan C T 5: 137,392,064 C4747Y unknown Het
Zfp804a T C 2: 82,259,192 F1122L probably benign Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16562319 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACGGATGCTGTGCAAAC -3'
(R):5'- GCACCCAGGGCAAGATCATTAC -3'

Sequencing Primer
(F):5'- GATGCTGTGCAAACCCCTC -3'
(R):5'- GGGCAAGATCATTACCATTCG -3'
Posted On2019-06-07