Incidental Mutation 'PIT4431001:Cope'
ID555245
Institutional Source Beutler Lab
Gene Symbol Cope
Ensembl Gene ENSMUSG00000055681
Gene Namecoatomer protein complex, subunit epsilon
Synonyms1110005D17Rik, Cope1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #PIT4431001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70302518-70312993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70312767 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 289 (E289G)
Ref Sequence ENSEMBL: ENSMUSP00000071078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066469] [ENSMUST00000128003] [ENSMUST00000140239] [ENSMUST00000150968] [ENSMUST00000165819] [ENSMUST00000168018]
Predicted Effect probably damaging
Transcript: ENSMUST00000066469
AA Change: E289G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071078
Gene: ENSMUSG00000055681
AA Change: E289G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 305 2.8e-134 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128003
AA Change: E205G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122888
Gene: ENSMUSG00000055681
AA Change: E205G

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 212 5.4e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150968
SMART Domains Protein: ENSMUSP00000119055
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 227 6.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165819
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000132976
Gene: ENSMUSG00000055681
AA Change: E96G

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 79 5.4e-38 PFAM
Pfam:Coatomer_E 75 113 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168018
SMART Domains Protein: ENSMUSP00000130416
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 79 4.5e-22 PFAM
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 90.7%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik A G 5: 146,502,512 I29V probably benign Het
5730455P16Rik C A 11: 80,363,924 C357F probably damaging Het
Actr1a A T 19: 46,382,292 probably null Het
Adcy1 C G 11: 7,064,089 Q164E possibly damaging Het
Arhgap35 A T 7: 16,561,611 S1176R possibly damaging Het
Atad2b A G 12: 5,031,795 T1235A possibly damaging Het
Atp8a2 T C 14: 59,654,626 D1091G probably benign Het
Bmp6 T C 13: 38,485,930 S397P probably benign Het
C3 A T 17: 57,206,242 N1468K probably benign Het
Ccnjl CGCG CGCGGCG 11: 43,579,707 probably benign Het
Ccr1 T C 9: 123,964,194 I100V probably benign Het
Cep162 T A 9: 87,244,345 R171S probably benign Het
Chd8 T C 14: 52,218,249 H994R probably damaging Het
Cntn3 T A 6: 102,464,566 K6N probably benign Het
Cpne8 T G 15: 90,551,975 E279A probably damaging Het
Cyp11a1 A T 9: 58,016,272 probably null Het
Dcp2 A G 18: 44,412,571 K333R probably benign Het
Dpp6 G T 5: 27,631,498 V329F probably benign Het
Drc1 T A 5: 30,347,073 D186E probably damaging Het
Dsc2 G A 18: 20,046,277 Q245* probably null Het
Eef1e1 T C 13: 38,658,962 E11G probably damaging Het
Emilin2 G A 17: 71,255,995 P915S probably benign Het
Fam214b C A 4: 43,036,024 G236C probably damaging Het
Fpgt A G 3: 155,086,785 M535T possibly damaging Het
Fxyd3 G A 7: 31,071,355 L37F probably damaging Het
Gal3st2c T A 1: 94,008,112 I62N probably damaging Het
Gdpd3 T C 7: 126,766,475 I2T probably benign Het
Gm9611 T C 14: 42,293,931 M169V Het
Ints3 G A 3: 90,396,460 T720I probably damaging Het
Itpr2 T G 6: 146,354,720 M992L probably benign Het
L3mbtl2 T A 15: 81,676,307 H256Q probably benign Het
Lama2 T C 10: 27,101,430 T1918A probably damaging Het
Lpcat2b G A 5: 107,434,131 G442D probably damaging Het
Lrp1b C T 2: 41,004,755 V2268M Het
Macc1 T C 12: 119,446,511 L338P probably benign Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Mtr C T 13: 12,212,443 V772M probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Myo5c A G 9: 75,252,571 I294V possibly damaging Het
Ncam1 A T 9: 49,798,693 F13I probably benign Het
Olfr1248 T C 2: 89,617,857 I112V probably benign Het
Paqr6 A T 3: 88,365,777 I52F possibly damaging Het
Pde2a T G 7: 101,501,897 V271G probably damaging Het
Pde7b T C 10: 20,400,545 H405R possibly damaging Het
Plxnb1 A G 9: 109,100,718 Y214C probably damaging Het
Pmp22 T C 11: 63,151,241 F101L probably benign Het
Pold1 A G 7: 44,538,894 L520P probably damaging Het
Pramel1 A G 4: 143,398,390 T295A possibly damaging Het
Psg20 A T 7: 18,674,550 I415N probably damaging Het
Ptcd2 T A 13: 99,340,019 R71* probably null Het
Ptgs1 A T 2: 36,240,680 N197I probably damaging Het
Rbfox3 T C 11: 118,495,221 D333G probably damaging Het
Rfx7 T A 9: 72,617,971 H814Q probably benign Het
Rptn TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG 3: 93,397,397 probably benign Het
Serpina3i A T 12: 104,265,173 H23L probably benign Het
Sipa1l1 T A 12: 82,396,516 V860E probably benign Het
Slc12a1 T A 2: 125,190,204 Y592N possibly damaging Het
Slco2a1 T C 9: 103,050,268 F120S probably damaging Het
Smyd4 T C 11: 75,403,513 F740S probably damaging Het
Sppl2a T C 2: 126,923,476 Y242C probably damaging Het
Sqle A G 15: 59,323,660 K288R probably benign Het
Tbc1d17 A G 7: 44,845,074 S246P probably benign Het
Tenm3 G A 8: 48,235,607 T2315M probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Thumpd3 T A 6: 113,059,978 N279K probably benign Het
Tmed5 T A 5: 108,130,021 H95L possibly damaging Het
Tmem161a T C 8: 70,182,024 L443P probably damaging Het
Ttc38 C A 15: 85,836,127 Q97K probably benign Het
Unc13c C A 9: 73,749,547 C1124F probably damaging Het
Vmn2r102 A G 17: 19,676,696 T102A possibly damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Xkr5 A T 8: 18,934,345 S394T possibly damaging Het
Zan C T 5: 137,392,064 C4747Y unknown Het
Zfp804a T C 2: 82,259,192 F1122L probably benign Het
Other mutations in Cope
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02696:Cope APN 8 70310493 critical splice donor site probably null
R0570:Cope UTSW 8 70306531 missense probably damaging 0.96
R1382:Cope UTSW 8 70312863 missense probably benign 0.00
R1518:Cope UTSW 8 70312761 missense possibly damaging 0.72
R4538:Cope UTSW 8 70306507 missense probably damaging 1.00
R4941:Cope UTSW 8 70302934 critical splice donor site probably null
R5106:Cope UTSW 8 70310447 missense possibly damaging 0.57
R5454:Cope UTSW 8 70304656 missense probably benign 0.17
R5764:Cope UTSW 8 70306581 missense probably damaging 1.00
R5979:Cope UTSW 8 70302543 splice site probably null
R6003:Cope UTSW 8 70304635 missense probably benign 0.01
R6010:Cope UTSW 8 70308512 missense probably damaging 1.00
R7074:Cope UTSW 8 70312887 missense probably benign 0.11
R8022:Cope UTSW 8 70312803 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCCAGGTTCCGTAATCTC -3'
(R):5'- GACTTTATTGGCAGACACAAAGG -3'

Sequencing Primer
(F):5'- CCAGGTTCCGTAATCTCTGGGG -3'
(R):5'- CACAAAGGGAGGACAGCATC -3'
Posted On2019-06-07